Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636410_at:

>probe:Drosophila_2:1636410_at:395:585; Interrogation_Position=1014; Antisense; TGGACTGGTGTCGTTCGGACCCGTT
>probe:Drosophila_2:1636410_at:542:79; Interrogation_Position=1075; Antisense; AGGGTGGCGTCCTACATCGATTGGA
>probe:Drosophila_2:1636410_at:704:637; Interrogation_Position=1091; Antisense; TCGATTGGATTCACGACAGTCTCAA
>probe:Drosophila_2:1636410_at:146:675; Interrogation_Position=632; Antisense; TAGCCATCGAGGAGTTGCTTCCACA
>probe:Drosophila_2:1636410_at:569:665; Interrogation_Position=664; Antisense; TACAATCGCACCGACAGGACGCAGA
>probe:Drosophila_2:1636410_at:393:651; Interrogation_Position=731; Antisense; TCAACGACTTTGTGCAACCCATTTG
>probe:Drosophila_2:1636410_at:41:549; Interrogation_Position=814; Antisense; GGATGGCAGGCTAGTTCCTCGCAAA
>probe:Drosophila_2:1636410_at:480:495; Interrogation_Position=881; Antisense; GTCAAAGGAAGTACGCCAGCCAGCA
>probe:Drosophila_2:1636410_at:329:115; Interrogation_Position=902; Antisense; AGCAGTTGCGCATCCAAGCCTCGAA
>probe:Drosophila_2:1636410_at:727:203; Interrogation_Position=917; Antisense; AAGCCTCGAAGCTCTGTGGCCTGAC
>probe:Drosophila_2:1636410_at:172:607; Interrogation_Position=938; Antisense; TGACCAATTCCCAGGAGTGCTACGG
>probe:Drosophila_2:1636410_at:1:87; Interrogation_Position=953; Antisense; AGTGCTACGGCAACGCTGGTGGACC
>probe:Drosophila_2:1636410_at:503:533; Interrogation_Position=970; Antisense; GGTGGACCACTGATGCTGTTCAAGA
>probe:Drosophila_2:1636410_at:675:193; Interrogation_Position=994; Antisense; AACGATGGCTATCTGCTCGGTGGAC

Paste this into a BLAST search page for me
TGGACTGGTGTCGTTCGGACCCGTTAGGGTGGCGTCCTACATCGATTGGATCGATTGGATTCACGACAGTCTCAATAGCCATCGAGGAGTTGCTTCCACATACAATCGCACCGACAGGACGCAGATCAACGACTTTGTGCAACCCATTTGGGATGGCAGGCTAGTTCCTCGCAAAGTCAAAGGAAGTACGCCAGCCAGCAAGCAGTTGCGCATCCAAGCCTCGAAAAGCCTCGAAGCTCTGTGGCCTGACTGACCAATTCCCAGGAGTGCTACGGAGTGCTACGGCAACGCTGGTGGACCGGTGGACCACTGATGCTGTTCAAGAAACGATGGCTATCTGCTCGGTGGAC

Full Affymetrix probeset data:

Annotations for 1636410_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime