Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636412_at:

>probe:Drosophila_2:1636412_at:453:175; Interrogation_Position=2551; Antisense; AAACCGCCAATATTGTGAGTAAATG
>probe:Drosophila_2:1636412_at:275:167; Interrogation_Position=2571; Antisense; AAATGCTGGCATTATTTTATATCAT
>probe:Drosophila_2:1636412_at:682:35; Interrogation_Position=2591; Antisense; ATCATGGATTGGTTCATACGCGAAT
>probe:Drosophila_2:1636412_at:215:27; Interrogation_Position=2606; Antisense; ATACGCGAATGTGCAGAAGGTCTGA
>probe:Drosophila_2:1636412_at:82:373; Interrogation_Position=2621; Antisense; GAAGGTCTGAGGATTGCCATCGCGT
>probe:Drosophila_2:1636412_at:401:607; Interrogation_Position=2628; Antisense; TGAGGATTGCCATCGCGTCACTTAA
>probe:Drosophila_2:1636412_at:541:635; Interrogation_Position=2640; Antisense; TCGCGTCACTTAATCATCCATTCAA
>probe:Drosophila_2:1636412_at:305:239; Interrogation_Position=2651; Antisense; AATCATCCATTCAAACATCTTGTTA
>probe:Drosophila_2:1636412_at:679:703; Interrogation_Position=2700; Antisense; TTATATTTCATTACCATTGCTCGTT
>probe:Drosophila_2:1636412_at:273:127; Interrogation_Position=2712; Antisense; ACCATTGCTCGTTTAAAATTGTTCG
>probe:Drosophila_2:1636412_at:627:247; Interrogation_Position=2728; Antisense; AATTGTTCGAACTCAGCTATCTCAT
>probe:Drosophila_2:1636412_at:595:471; Interrogation_Position=2732; Antisense; GTTCGAACTCAGCTATCTCATGTAC
>probe:Drosophila_2:1636412_at:663:145; Interrogation_Position=2738; Antisense; ACTCAGCTATCTCATGTACATTCAA
>probe:Drosophila_2:1636412_at:476:473; Interrogation_Position=2774; Antisense; GTTAATCACATATGTAAAACGCAAG

Paste this into a BLAST search page for me
AAACCGCCAATATTGTGAGTAAATGAAATGCTGGCATTATTTTATATCATATCATGGATTGGTTCATACGCGAATATACGCGAATGTGCAGAAGGTCTGAGAAGGTCTGAGGATTGCCATCGCGTTGAGGATTGCCATCGCGTCACTTAATCGCGTCACTTAATCATCCATTCAAAATCATCCATTCAAACATCTTGTTATTATATTTCATTACCATTGCTCGTTACCATTGCTCGTTTAAAATTGTTCGAATTGTTCGAACTCAGCTATCTCATGTTCGAACTCAGCTATCTCATGTACACTCAGCTATCTCATGTACATTCAAGTTAATCACATATGTAAAACGCAAG

Full Affymetrix probeset data:

Annotations for 1636412_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime