FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636414_at:

>probe:Drosophila_2:1636414_at:255:115; Interrogation_Position=1057; Antisense; AGCAGTCGTCGAGCCAAGTTCAGGA
>probe:Drosophila_2:1636414_at:448:239; Interrogation_Position=1084; Antisense; AATCAGATGAGTCGCGATGTGCCCG
>probe:Drosophila_2:1636414_at:505:317; Interrogation_Position=1116; Antisense; GCCGGACACTCATCAAACCGTGAAT
>probe:Drosophila_2:1636414_at:496:105; Interrogation_Position=1190; Antisense; AGAAATACAACGAGACCCGCATCCG
>probe:Drosophila_2:1636414_at:382:593; Interrogation_Position=1223; Antisense; TGGGTCGTCACCAGAGCATCAGCGT
>probe:Drosophila_2:1636414_at:229:587; Interrogation_Position=1247; Antisense; TGGACTGGCGGGTCAGCGACAATCT
>probe:Drosophila_2:1636414_at:201:397; Interrogation_Position=1264; Antisense; GACAATCTGGAGTACCGCTCCATGA
>probe:Drosophila_2:1636414_at:28:167; Interrogation_Position=796; Antisense; AAATCCCTGGTCCAGTCGCAGCGAA
>probe:Drosophila_2:1636414_at:127:503; Interrogation_Position=810; Antisense; GTCGCAGCGAAAGTCCACGGTGCAA
>probe:Drosophila_2:1636414_at:396:535; Interrogation_Position=828; Antisense; GGTGCAAACCATGAGCAGTTCCAAT
>probe:Drosophila_2:1636414_at:407:115; Interrogation_Position=841; Antisense; AGCAGTTCCAATGCCAGGAGCTTCA
>probe:Drosophila_2:1636414_at:460:75; Interrogation_Position=856; Antisense; AGGAGCTTCACCAACCAGCAAGTAC
>probe:Drosophila_2:1636414_at:39:267; Interrogation_Position=930; Antisense; CAGTAACACCAGCTCCAGCAATTAT
>probe:Drosophila_2:1636414_at:449:245; Interrogation_Position=949; Antisense; AATTATATAGCCTCCAACGCCAGCA

Paste this into a BLAST search page for me
AGCAGTCGTCGAGCCAAGTTCAGGAAATCAGATGAGTCGCGATGTGCCCGGCCGGACACTCATCAAACCGTGAATAGAAATACAACGAGACCCGCATCCGTGGGTCGTCACCAGAGCATCAGCGTTGGACTGGCGGGTCAGCGACAATCTGACAATCTGGAGTACCGCTCCATGAAAATCCCTGGTCCAGTCGCAGCGAAGTCGCAGCGAAAGTCCACGGTGCAAGGTGCAAACCATGAGCAGTTCCAATAGCAGTTCCAATGCCAGGAGCTTCAAGGAGCTTCACCAACCAGCAAGTACCAGTAACACCAGCTCCAGCAATTATAATTATATAGCCTCCAACGCCAGCA

Full Affymetrix probeset data:

Annotations for 1636414_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720