FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636415_at:

>probe:Drosophila_2:1636415_at:708:497; Interrogation_Position=1567; Antisense; GTCTATTGGTGCAAGCTATCCAGCA
>probe:Drosophila_2:1636415_at:413:171; Interrogation_Position=1591; Antisense; AAAGTGCACGATGCCTGCGACGATA
>probe:Drosophila_2:1636415_at:667:405; Interrogation_Position=1609; Antisense; GACGATAGTTCCTCCATCGAGACGA
>probe:Drosophila_2:1636415_at:531:243; Interrogation_Position=1657; Antisense; AATTTCTCCGGAATCCAGGGCGTGA
>probe:Drosophila_2:1636415_at:157:611; Interrogation_Position=1746; Antisense; TGACAGCGAGGTGCCCGAGAAGCCA
>probe:Drosophila_2:1636415_at:319:37; Interrogation_Position=1774; Antisense; ATCTTGCGGTACGTGGAGGGCACCA
>probe:Drosophila_2:1636415_at:425:337; Interrogation_Position=1821; Antisense; GCTCGTCTTGGCCATTCAGAAGCTG
>probe:Drosophila_2:1636415_at:5:401; Interrogation_Position=1858; Antisense; GACATCCGGGTTGAACTGCCAGTGA
>probe:Drosophila_2:1636415_at:123:375; Interrogation_Position=1888; Antisense; GAAGAGCCCACAGCAAATCCACTTG
>probe:Drosophila_2:1636415_at:239:151; Interrogation_Position=1908; Antisense; ACTTGGCGATGTACGCCTGTTCTAT
>probe:Drosophila_2:1636415_at:265:567; Interrogation_Position=1963; Antisense; GGCACAGTGCGCAAAACCGTGACAT
>probe:Drosophila_2:1636415_at:462:101; Interrogation_Position=2022; Antisense; AGAGCTGCAGGAGGTGCCCAGACCA
>probe:Drosophila_2:1636415_at:617:67; Interrogation_Position=2060; Antisense; AGGCCGATGCGTACGTAACCAATCA
>probe:Drosophila_2:1636415_at:315:239; Interrogation_Position=2080; Antisense; AATCAGTATGTGTCCATGAGCGCAA

Paste this into a BLAST search page for me
GTCTATTGGTGCAAGCTATCCAGCAAAAGTGCACGATGCCTGCGACGATAGACGATAGTTCCTCCATCGAGACGAAATTTCTCCGGAATCCAGGGCGTGATGACAGCGAGGTGCCCGAGAAGCCAATCTTGCGGTACGTGGAGGGCACCAGCTCGTCTTGGCCATTCAGAAGCTGGACATCCGGGTTGAACTGCCAGTGAGAAGAGCCCACAGCAAATCCACTTGACTTGGCGATGTACGCCTGTTCTATGGCACAGTGCGCAAAACCGTGACATAGAGCTGCAGGAGGTGCCCAGACCAAGGCCGATGCGTACGTAACCAATCAAATCAGTATGTGTCCATGAGCGCAA

Full Affymetrix probeset data:

Annotations for 1636415_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720