FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636419_at:

>probe:Drosophila_2:1636419_at:387:61; Interrogation_Position=3465; Antisense; ATGTGCTTAATCATGAGCTCTCGGA
>probe:Drosophila_2:1636419_at:159:119; Interrogation_Position=3480; Antisense; AGCTCTCGGAGCAGCAACTGGCTAT
>probe:Drosophila_2:1636419_at:531:651; Interrogation_Position=3522; Antisense; TACTAGTTCACGAGGAGCAGCCGGC
>probe:Drosophila_2:1636419_at:301:113; Interrogation_Position=3537; Antisense; AGCAGCCGGCTTTGCTGGAGGTAAT
>probe:Drosophila_2:1636419_at:466:435; Interrogation_Position=3554; Antisense; GAGGTAATACCACCAGGACTCTCGT
>probe:Drosophila_2:1636419_at:701:73; Interrogation_Position=3568; Antisense; AGGACTCTCGTCTAGGCCGATCGAG
>probe:Drosophila_2:1636419_at:529:69; Interrogation_Position=3663; Antisense; AGGCCAACGACGACTCCAATATCAA
>probe:Drosophila_2:1636419_at:725:509; Interrogation_Position=3726; Antisense; GTGAATTGCAAGACGATGCGCTCGG
>probe:Drosophila_2:1636419_at:123:403; Interrogation_Position=3775; Antisense; GACTTCGGATAACTGATTGGCCTTA
>probe:Drosophila_2:1636419_at:314:577; Interrogation_Position=3793; Antisense; GGCCTTAGCCATATATCCAATTTAC
>probe:Drosophila_2:1636419_at:453:47; Interrogation_Position=3807; Antisense; ATCCAATTTACACTAGCATGCCCTC
>probe:Drosophila_2:1636419_at:291:51; Interrogation_Position=3824; Antisense; ATGCCCTCCTCATTCTATTAGGAGC
>probe:Drosophila_2:1636419_at:210:363; Interrogation_Position=3900; Antisense; GAATTGGAGCTACCACGAATTGAGA
>probe:Drosophila_2:1636419_at:27:367; Interrogation_Position=3923; Antisense; GAATAAACTTCTTTCGGATAGCATT

Paste this into a BLAST search page for me
ATGTGCTTAATCATGAGCTCTCGGAAGCTCTCGGAGCAGCAACTGGCTATTACTAGTTCACGAGGAGCAGCCGGCAGCAGCCGGCTTTGCTGGAGGTAATGAGGTAATACCACCAGGACTCTCGTAGGACTCTCGTCTAGGCCGATCGAGAGGCCAACGACGACTCCAATATCAAGTGAATTGCAAGACGATGCGCTCGGGACTTCGGATAACTGATTGGCCTTAGGCCTTAGCCATATATCCAATTTACATCCAATTTACACTAGCATGCCCTCATGCCCTCCTCATTCTATTAGGAGCGAATTGGAGCTACCACGAATTGAGAGAATAAACTTCTTTCGGATAGCATT

Full Affymetrix probeset data:

Annotations for 1636419_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720