FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636420_at:

>probe:Drosophila_2:1636420_at:660:397; Interrogation_Position=1075; Antisense; GACAACTCCAGCAATGACGACGAAT
>probe:Drosophila_2:1636420_at:326:31; Interrogation_Position=601; Antisense; ATAAATGAGCTACTCTCCCGGTATT
>probe:Drosophila_2:1636420_at:717:539; Interrogation_Position=620; Antisense; GGTATTCCGGATATCTGCACAGCTG
>probe:Drosophila_2:1636420_at:109:123; Interrogation_Position=660; Antisense; AGCGCAGCAAGCCACGTTTGAGCAA
>probe:Drosophila_2:1636420_at:509:99; Interrogation_Position=693; Antisense; AGAGGCCATCGAAAAGTACCACAAT
>probe:Drosophila_2:1636420_at:453:159; Interrogation_Position=713; Antisense; ACAATGCCACCAACGAACTGACGGA
>probe:Drosophila_2:1636420_at:518:611; Interrogation_Position=731; Antisense; TGACGGACCAAGTCGAGCTCTGCGT
>probe:Drosophila_2:1636420_at:113:599; Interrogation_Position=776; Antisense; TGTCCTGCCGCAATGGCATCAATGA
>probe:Drosophila_2:1636420_at:517:345; Interrogation_Position=791; Antisense; GCATCAATGAGGCACTACGCGGACT
>probe:Drosophila_2:1636420_at:185:367; Interrogation_Position=846; Antisense; GAAGCTTCAAGGCATCCGACTACTG
>probe:Drosophila_2:1636420_at:445:41; Interrogation_Position=874; Antisense; ATCGGCCTGAATGCCAGCGGATGTG
>probe:Drosophila_2:1636420_at:281:109; Interrogation_Position=929; Antisense; AGAAGCCCAGCGTGGAGCGCAAGCT
>probe:Drosophila_2:1636420_at:673:419; Interrogation_Position=979; Antisense; GAGCAGCAGACTTCCACCGATGACG
>probe:Drosophila_2:1636420_at:60:133; Interrogation_Position=994; Antisense; ACCGATGACGACTCTAGCTCTAATA

Paste this into a BLAST search page for me
GACAACTCCAGCAATGACGACGAATATAAATGAGCTACTCTCCCGGTATTGGTATTCCGGATATCTGCACAGCTGAGCGCAGCAAGCCACGTTTGAGCAAAGAGGCCATCGAAAAGTACCACAATACAATGCCACCAACGAACTGACGGATGACGGACCAAGTCGAGCTCTGCGTTGTCCTGCCGCAATGGCATCAATGAGCATCAATGAGGCACTACGCGGACTGAAGCTTCAAGGCATCCGACTACTGATCGGCCTGAATGCCAGCGGATGTGAGAAGCCCAGCGTGGAGCGCAAGCTGAGCAGCAGACTTCCACCGATGACGACCGATGACGACTCTAGCTCTAATA

Full Affymetrix probeset data:

Annotations for 1636420_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720