FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636421_at:

>probe:Drosophila_2:1636421_at:120:415; Interrogation_Position=172; Antisense; GAGCGCCTGATCAGGGATCCCGAGT
>probe:Drosophila_2:1636421_at:448:51; Interrogation_Position=290; Antisense; ATGCGGTGACCATCGACATGTGCGG
>probe:Drosophila_2:1636421_at:171:417; Interrogation_Position=334; Antisense; GAGCGCTACGAGATGCTGGACTTCA
>probe:Drosophila_2:1636421_at:250:587; Interrogation_Position=350; Antisense; TGGACTTCATCGACTGCTACATCGA
>probe:Drosophila_2:1636421_at:499:269; Interrogation_Position=399; Antisense; CATGGAGGTGGTTCTGCAGGTCTTC
>probe:Drosophila_2:1636421_at:42:567; Interrogation_Position=450; Antisense; GGCACTGATGGATCTCGTGGCGAAA
>probe:Drosophila_2:1636421_at:464:349; Interrogation_Position=495; Antisense; GCAGGTGCTCATGGACAACTCGTTC
>probe:Drosophila_2:1636421_at:2:195; Interrogation_Position=511; Antisense; AACTCGTTCCTCAAGCTGAGTGTTA
>probe:Drosophila_2:1636421_at:665:65; Interrogation_Position=572; Antisense; ATGGAGATCTCTCCGATCACGAACT
>probe:Drosophila_2:1636421_at:309:193; Interrogation_Position=593; Antisense; AACTGCTGACCTCGCTGAAGAACTA
>probe:Drosophila_2:1636421_at:412:547; Interrogation_Position=621; Antisense; GGATGTGAACAACCTGCGCTACGAG
>probe:Drosophila_2:1636421_at:585:469; Interrogation_Position=657; Antisense; GTTCCAGCAGCTCGTTGAGGTAACC
>probe:Drosophila_2:1636421_at:468:435; Interrogation_Position=673; Antisense; GAGGTAACCCAGTTGTTCGGTCACG
>probe:Drosophila_2:1636421_at:415:635; Interrogation_Position=689; Antisense; TCGGTCACGTTCTCTTCGAAGTGGA

Paste this into a BLAST search page for me
GAGCGCCTGATCAGGGATCCCGAGTATGCGGTGACCATCGACATGTGCGGGAGCGCTACGAGATGCTGGACTTCATGGACTTCATCGACTGCTACATCGACATGGAGGTGGTTCTGCAGGTCTTCGGCACTGATGGATCTCGTGGCGAAAGCAGGTGCTCATGGACAACTCGTTCAACTCGTTCCTCAAGCTGAGTGTTAATGGAGATCTCTCCGATCACGAACTAACTGCTGACCTCGCTGAAGAACTAGGATGTGAACAACCTGCGCTACGAGGTTCCAGCAGCTCGTTGAGGTAACCGAGGTAACCCAGTTGTTCGGTCACGTCGGTCACGTTCTCTTCGAAGTGGA

Full Affymetrix probeset data:

Annotations for 1636421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720