FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636423_at:

>probe:Drosophila_2:1636423_at:73:263; Interrogation_Position=145; Antisense; CAGCTGTTGGTCACGACGCCAGTGA
>probe:Drosophila_2:1636423_at:648:411; Interrogation_Position=159; Antisense; GACGCCAGTGAGTTATGCCACCGGA
>probe:Drosophila_2:1636423_at:34:707; Interrogation_Position=219; Antisense; TTACTATCCGGCGTATGCCAGCTAT
>probe:Drosophila_2:1636423_at:88:575; Interrogation_Position=255; Antisense; GGCGTATGCGTATGCACCGGTTTAT
>probe:Drosophila_2:1636423_at:266:51; Interrogation_Position=266; Antisense; ATGCACCGGTTTATGGCGCATACGC
>probe:Drosophila_2:1636423_at:478:23; Interrogation_Position=285; Antisense; ATACGCCACGTATCCATACTACTCG
>probe:Drosophila_2:1636423_at:638:25; Interrogation_Position=300; Antisense; ATACTACTCGTATCTAGGGCGGTGA
>probe:Drosophila_2:1636423_at:571:533; Interrogation_Position=320; Antisense; GGTGAATCCTGCTGCTGCGGGCCAA
>probe:Drosophila_2:1636423_at:343:327; Interrogation_Position=336; Antisense; GCGGGCCAACCGGAATACTAGGTGA
>probe:Drosophila_2:1636423_at:132:511; Interrogation_Position=357; Antisense; GTGAATTTGTAGCTATTCCGGGCTT
>probe:Drosophila_2:1636423_at:551:7; Interrogation_Position=371; Antisense; ATTCCGGGCTTGTGTACAGTGGCAG
>probe:Drosophila_2:1636423_at:444:567; Interrogation_Position=391; Antisense; GGCAGCAATGTTCCACTTACTAGAA
>probe:Drosophila_2:1636423_at:409:515; Interrogation_Position=540; Antisense; GTGTCCCTTGTGAAATTAATGTTCC
>probe:Drosophila_2:1636423_at:423:3; Interrogation_Position=609; Antisense; ATTGGCCCACCTTTAGATAATTCTT

Paste this into a BLAST search page for me
CAGCTGTTGGTCACGACGCCAGTGAGACGCCAGTGAGTTATGCCACCGGATTACTATCCGGCGTATGCCAGCTATGGCGTATGCGTATGCACCGGTTTATATGCACCGGTTTATGGCGCATACGCATACGCCACGTATCCATACTACTCGATACTACTCGTATCTAGGGCGGTGAGGTGAATCCTGCTGCTGCGGGCCAAGCGGGCCAACCGGAATACTAGGTGAGTGAATTTGTAGCTATTCCGGGCTTATTCCGGGCTTGTGTACAGTGGCAGGGCAGCAATGTTCCACTTACTAGAAGTGTCCCTTGTGAAATTAATGTTCCATTGGCCCACCTTTAGATAATTCTT

Full Affymetrix probeset data:

Annotations for 1636423_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720