Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636425_at:

>probe:Drosophila_2:1636425_at:368:207; Interrogation_Position=1052; Antisense; AAGCAGGTGGTATTGTTGGCATCGA
>probe:Drosophila_2:1636425_at:364:617; Interrogation_Position=1083; Antisense; TGCATTTTTTGCCACAGTTCGGATG
>probe:Drosophila_2:1636425_at:606:439; Interrogation_Position=1104; Antisense; GATGGCATATTCCTTTTACACTTTA
>probe:Drosophila_2:1636425_at:287:157; Interrogation_Position=1121; Antisense; ACACTTTAGCCTTGTCATTTCGAGT
>probe:Drosophila_2:1636425_at:678:21; Interrogation_Position=585; Antisense; ATATCCGCCGATTACATTTTGTGTG
>probe:Drosophila_2:1636425_at:609:667; Interrogation_Position=597; Antisense; TACATTTTGTGTGGTCTCTGGACAT
>probe:Drosophila_2:1636425_at:658:387; Interrogation_Position=692; Antisense; GAAAACTCATCGAAGGTATCCAGGA
>probe:Drosophila_2:1636425_at:677:215; Interrogation_Position=733; Antisense; AAGATAATACGCCTACTTCGCAGCA
>probe:Drosophila_2:1636425_at:510:355; Interrogation_Position=755; Antisense; GCACTTTACATCTTAGCCAACTGGG
>probe:Drosophila_2:1636425_at:74:579; Interrogation_Position=776; Antisense; TGGGCCAGTTCCTTTCTAGTGGAAT
>probe:Drosophila_2:1636425_at:346:255; Interrogation_Position=801; Antisense; CAACATTTCCATAACACTCATCAAC
>probe:Drosophila_2:1636425_at:618:33; Interrogation_Position=820; Antisense; ATCAACATCCTGTTCTTTGCGGAAA
>probe:Drosophila_2:1636425_at:715:687; Interrogation_Position=862; Antisense; TATTATGCGGTGTTCTTTGCTGCAA
>probe:Drosophila_2:1636425_at:547:23; Interrogation_Position=954; Antisense; ATATGCCATCTTCTCCAGCAACTGG

Paste this into a BLAST search page for me
AAGCAGGTGGTATTGTTGGCATCGATGCATTTTTTGCCACAGTTCGGATGGATGGCATATTCCTTTTACACTTTAACACTTTAGCCTTGTCATTTCGAGTATATCCGCCGATTACATTTTGTGTGTACATTTTGTGTGGTCTCTGGACATGAAAACTCATCGAAGGTATCCAGGAAAGATAATACGCCTACTTCGCAGCAGCACTTTACATCTTAGCCAACTGGGTGGGCCAGTTCCTTTCTAGTGGAATCAACATTTCCATAACACTCATCAACATCAACATCCTGTTCTTTGCGGAAATATTATGCGGTGTTCTTTGCTGCAAATATGCCATCTTCTCCAGCAACTGG

Full Affymetrix probeset data:

Annotations for 1636425_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime