FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636426_at:

>probe:Drosophila_2:1636426_at:353:507; Interrogation_Position=108; Antisense; GTGCTGTCGCCTTCATTGGTTCAAG
>probe:Drosophila_2:1636426_at:466:541; Interrogation_Position=125; Antisense; GGTTCAAGGCCAAGGTCATGTGCTG
>probe:Drosophila_2:1636426_at:699:123; Interrogation_Position=154; Antisense; AGCCGGTAACGGAGCTGTGTCTCAC
>probe:Drosophila_2:1636426_at:162:499; Interrogation_Position=172; Antisense; GTCTCACCTGCATTTGTGAGGCCAT
>probe:Drosophila_2:1636426_at:280:439; Interrogation_Position=189; Antisense; GAGGCCATTAGTGGTTGCAATGCCA
>probe:Drosophila_2:1636426_at:450:233; Interrogation_Position=207; Antisense; AATGCCACGGCGATTTGCACCAGTG
>probe:Drosophila_2:1636426_at:539:227; Interrogation_Position=303; Antisense; AATGGAGAGCATCCCGATTCGGAAA
>probe:Drosophila_2:1636426_at:509:169; Interrogation_Position=326; Antisense; AAAGGCTTTCATCAACTGCGCCAAG
>probe:Drosophila_2:1636426_at:554:143; Interrogation_Position=358; Antisense; ACTGTGCCGCCGATTTGGTGCAAAA
>probe:Drosophila_2:1636426_at:601:441; Interrogation_Position=42; Antisense; GATGTTATTACTTTAACCAGCCGGA
>probe:Drosophila_2:1636426_at:67:67; Interrogation_Position=426; Antisense; ATGGATTGCCACGATTATGCTCGAA
>probe:Drosophila_2:1636426_at:150:401; Interrogation_Position=483; Antisense; GACATGCCCTACAATTTCCAGAGTG
>probe:Drosophila_2:1636426_at:699:323; Interrogation_Position=71; Antisense; GCGAGTTTTCCTGCTATATTCCATA
>probe:Drosophila_2:1636426_at:686:21; Interrogation_Position=93; Antisense; ATATATTTGCTGCTGGTGCTGTCGC

Paste this into a BLAST search page for me
GTGCTGTCGCCTTCATTGGTTCAAGGGTTCAAGGCCAAGGTCATGTGCTGAGCCGGTAACGGAGCTGTGTCTCACGTCTCACCTGCATTTGTGAGGCCATGAGGCCATTAGTGGTTGCAATGCCAAATGCCACGGCGATTTGCACCAGTGAATGGAGAGCATCCCGATTCGGAAAAAAGGCTTTCATCAACTGCGCCAAGACTGTGCCGCCGATTTGGTGCAAAAGATGTTATTACTTTAACCAGCCGGAATGGATTGCCACGATTATGCTCGAAGACATGCCCTACAATTTCCAGAGTGGCGAGTTTTCCTGCTATATTCCATAATATATTTGCTGCTGGTGCTGTCGC

Full Affymetrix probeset data:

Annotations for 1636426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720