Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636427_a_at:

>probe:Drosophila_2:1636427_a_at:161:669; Interrogation_Position=476; Antisense; TACTCGATATCGCTACTATTGCATC
>probe:Drosophila_2:1636427_a_at:659:219; Interrogation_Position=507; Antisense; AAGGGTGCAGACTTTCCATTTGCCG
>probe:Drosophila_2:1636427_a_at:240:167; Interrogation_Position=550; Antisense; AAATGCCGGGTGCTATAGCCCAGAA
>probe:Drosophila_2:1636427_a_at:638:643; Interrogation_Position=575; Antisense; TCAGGGTCTTTCACAAATTGCCGAG
>probe:Drosophila_2:1636427_a_at:178:387; Interrogation_Position=609; Antisense; GAAAATGTATCACCCGATTTCCTGG
>probe:Drosophila_2:1636427_a_at:427:507; Interrogation_Position=633; Antisense; GTGCCCGACGATGTCTTGACCAAAA
>probe:Drosophila_2:1636427_a_at:725:433; Interrogation_Position=735; Antisense; GAGGGCACGGGCTCTGCATACACAC
>probe:Drosophila_2:1636427_a_at:208:665; Interrogation_Position=753; Antisense; TACACACCGCTTTCGGAGGACGAAT
>probe:Drosophila_2:1636427_a_at:444:261; Interrogation_Position=780; Antisense; CACCGCATCTTCGAGTTGGTCAAGG
>probe:Drosophila_2:1636427_a_at:216:461; Interrogation_Position=845; Antisense; GATTTTGCAGCAACGCTTGGACCTG
>probe:Drosophila_2:1636427_a_at:712:723; Interrogation_Position=870; Antisense; TTGCACCAGGTGAGACTGCGCTATT
>probe:Drosophila_2:1636427_a_at:61:135; Interrogation_Position=897; Antisense; ACGCCACGGGAAGTTGCTCGTCTAA
>probe:Drosophila_2:1636427_a_at:243:333; Interrogation_Position=912; Antisense; GCTCGTCTAATGAGTTTTCCGGAGA
>probe:Drosophila_2:1636427_a_at:269:549; Interrogation_Position=932; Antisense; GGAGAATTTTGAATTTCCGCCAGAA

Paste this into a BLAST search page for me
TACTCGATATCGCTACTATTGCATCAAGGGTGCAGACTTTCCATTTGCCGAAATGCCGGGTGCTATAGCCCAGAATCAGGGTCTTTCACAAATTGCCGAGGAAAATGTATCACCCGATTTCCTGGGTGCCCGACGATGTCTTGACCAAAAGAGGGCACGGGCTCTGCATACACACTACACACCGCTTTCGGAGGACGAATCACCGCATCTTCGAGTTGGTCAAGGGATTTTGCAGCAACGCTTGGACCTGTTGCACCAGGTGAGACTGCGCTATTACGCCACGGGAAGTTGCTCGTCTAAGCTCGTCTAATGAGTTTTCCGGAGAGGAGAATTTTGAATTTCCGCCAGAA

Full Affymetrix probeset data:

Annotations for 1636427_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime