FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636429_at:

>probe:Drosophila_2:1636429_at:227:147; Interrogation_Position=274; Antisense; ACTTCGGAGCCCAGGATGCTTTCGA
>probe:Drosophila_2:1636429_at:623:77; Interrogation_Position=286; Antisense; AGGATGCTTTCGATGCCGCCGACAG
>probe:Drosophila_2:1636429_at:39:123; Interrogation_Position=339; Antisense; AGCGACGCCGGGTTCAAGATCTCTC
>probe:Drosophila_2:1636429_at:146:141; Interrogation_Position=384; Antisense; ACGGCGGAATCGGTGAATCTAGAGC
>probe:Drosophila_2:1636429_at:168:69; Interrogation_Position=412; Antisense; AGGCCATTCCCTCGAAGGTGCTGAG
>probe:Drosophila_2:1636429_at:180:535; Interrogation_Position=428; Antisense; GGTGCTGAGCGTGTACGACAACAGT
>probe:Drosophila_2:1636429_at:523:703; Interrogation_Position=490; Antisense; TTTTGGACTCCATCAGTGAGCACGA
>probe:Drosophila_2:1636429_at:119:421; Interrogation_Position=513; Antisense; GAGAAGTACGGCAACAACGGTGACA
>probe:Drosophila_2:1636429_at:651:197; Interrogation_Position=528; Antisense; AACGGTGACATGTTCGACGGCATCT
>probe:Drosophila_2:1636429_at:113:347; Interrogation_Position=547; Antisense; GCATCTCGCGATCCATTGTCAACGG
>probe:Drosophila_2:1636429_at:552:5; Interrogation_Position=561; Antisense; ATTGTCAACGGCTACGAGGCCTTTT
>probe:Drosophila_2:1636429_at:181:203; Interrogation_Position=588; Antisense; AACCTGCTCAACACCTTTATTCAGA
>probe:Drosophila_2:1636429_at:246:125; Interrogation_Position=613; Antisense; AGCCCAAAGAGTTGGCGCGCAGCGT
>probe:Drosophila_2:1636429_at:453:545; Interrogation_Position=646; Antisense; GGATCACGGCTCAATTGGATATCAT

Paste this into a BLAST search page for me
ACTTCGGAGCCCAGGATGCTTTCGAAGGATGCTTTCGATGCCGCCGACAGAGCGACGCCGGGTTCAAGATCTCTCACGGCGGAATCGGTGAATCTAGAGCAGGCCATTCCCTCGAAGGTGCTGAGGGTGCTGAGCGTGTACGACAACAGTTTTTGGACTCCATCAGTGAGCACGAGAGAAGTACGGCAACAACGGTGACAAACGGTGACATGTTCGACGGCATCTGCATCTCGCGATCCATTGTCAACGGATTGTCAACGGCTACGAGGCCTTTTAACCTGCTCAACACCTTTATTCAGAAGCCCAAAGAGTTGGCGCGCAGCGTGGATCACGGCTCAATTGGATATCAT

Full Affymetrix probeset data:

Annotations for 1636429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720