Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636431_at:

>probe:Drosophila_2:1636431_at:47:143; Interrogation_Position=1001; Antisense; ACTGAATTCTGGTTACACGTATGCT
>probe:Drosophila_2:1636431_at:109:25; Interrogation_Position=1052; Antisense; ATAGATGTTAGTACCAAGCGCAAAT
>probe:Drosophila_2:1636431_at:555:53; Interrogation_Position=1106; Antisense; ATGAATCACGCCCTCCGAAAATAGA
>probe:Drosophila_2:1636431_at:11:479; Interrogation_Position=1143; Antisense; GTTTACTCATTAGTCTTGTCCACCA
>probe:Drosophila_2:1636431_at:624:497; Interrogation_Position=1155; Antisense; GTCTTGTCCACCAGTATTTCATCAT
>probe:Drosophila_2:1636431_at:257:235; Interrogation_Position=672; Antisense; AATGCCATGGATACACCTGCACGAT
>probe:Drosophila_2:1636431_at:321:519; Interrogation_Position=742; Antisense; GTGGTCAATGCGGTGGCCCCAGAAA
>probe:Drosophila_2:1636431_at:171:483; Interrogation_Position=821; Antisense; GTATCTTCGGCGTTCCAGAGTTTGT
>probe:Drosophila_2:1636431_at:590:265; Interrogation_Position=836; Antisense; CAGAGTTTGTTGTCCAAGCCATCTT
>probe:Drosophila_2:1636431_at:713:203; Interrogation_Position=851; Antisense; AAGCCATCTTTGGACCAGAGCGGGC
>probe:Drosophila_2:1636431_at:467:351; Interrogation_Position=874; Antisense; GCAGCTCTGGTTTTAAGTGGTGCCA
>probe:Drosophila_2:1636431_at:388:125; Interrogation_Position=905; Antisense; AGCCACAGAAAGCTCTATCATCCGG
>probe:Drosophila_2:1636431_at:426:709; Interrogation_Position=932; Antisense; TTAAATTTCAATATCCCAGCGTCAA
>probe:Drosophila_2:1636431_at:13:213; Interrogation_Position=956; Antisense; AAGAGGCTGTGACGCAACTGACCCT

Paste this into a BLAST search page for me
ACTGAATTCTGGTTACACGTATGCTATAGATGTTAGTACCAAGCGCAAATATGAATCACGCCCTCCGAAAATAGAGTTTACTCATTAGTCTTGTCCACCAGTCTTGTCCACCAGTATTTCATCATAATGCCATGGATACACCTGCACGATGTGGTCAATGCGGTGGCCCCAGAAAGTATCTTCGGCGTTCCAGAGTTTGTCAGAGTTTGTTGTCCAAGCCATCTTAAGCCATCTTTGGACCAGAGCGGGCGCAGCTCTGGTTTTAAGTGGTGCCAAGCCACAGAAAGCTCTATCATCCGGTTAAATTTCAATATCCCAGCGTCAAAAGAGGCTGTGACGCAACTGACCCT

Full Affymetrix probeset data:

Annotations for 1636431_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime