FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636433_at:

>probe:Drosophila_2:1636433_at:289:695; Interrogation_Position=1409; Antisense; TTTCTGCCCGTACGAAGATGTGCTT
>probe:Drosophila_2:1636433_at:538:61; Interrogation_Position=1426; Antisense; ATGTGCTTGGTGTGTCGACGGCCAA
>probe:Drosophila_2:1636433_at:106:223; Interrogation_Position=1449; Antisense; AAGGGCTTCCAATCGCTATTGGTGC
>probe:Drosophila_2:1636433_at:432:425; Interrogation_Position=1483; Antisense; GAGAGCCCAACTTCGATGCTATGGA
>probe:Drosophila_2:1636433_at:513:235; Interrogation_Position=1512; Antisense; AATCCGTATGAGACTTCGAAGCAAC
>probe:Drosophila_2:1636433_at:74:111; Interrogation_Position=1531; Antisense; AGCAACGACGCGAGCACGAGGTTCA
>probe:Drosophila_2:1636433_at:53:295; Interrogation_Position=1547; Antisense; CGAGGTTCACGCTCTGCTGGAGAAG
>probe:Drosophila_2:1636433_at:556:331; Interrogation_Position=1562; Antisense; GCTGGAGAAGATTCCGCCCGAACTG
>probe:Drosophila_2:1636433_at:245:195; Interrogation_Position=1582; Antisense; AACTGATCACCCTGGATCCGCAAGA
>probe:Drosophila_2:1636433_at:182:207; Interrogation_Position=1659; Antisense; AAGCTGTTCCATTTGAAGGCGCCGC
>probe:Drosophila_2:1636433_at:537:227; Interrogation_Position=1674; Antisense; AAGGCGCCGCGCATCAACATGAAAT
>probe:Drosophila_2:1636433_at:324:71; Interrogation_Position=1735; Antisense; AGGCGGCGCGCAACAAACAGATCGT
>probe:Drosophila_2:1636433_at:439:161; Interrogation_Position=1775; Antisense; AAAGGAGTTTATTGCCGAGGTGCGC
>probe:Drosophila_2:1636433_at:456:135; Interrogation_Position=1877; Antisense; ACGCTCCGTTCTGGATCGTTTCAAA

Paste this into a BLAST search page for me
TTTCTGCCCGTACGAAGATGTGCTTATGTGCTTGGTGTGTCGACGGCCAAAAGGGCTTCCAATCGCTATTGGTGCGAGAGCCCAACTTCGATGCTATGGAAATCCGTATGAGACTTCGAAGCAACAGCAACGACGCGAGCACGAGGTTCACGAGGTTCACGCTCTGCTGGAGAAGGCTGGAGAAGATTCCGCCCGAACTGAACTGATCACCCTGGATCCGCAAGAAAGCTGTTCCATTTGAAGGCGCCGCAAGGCGCCGCGCATCAACATGAAATAGGCGGCGCGCAACAAACAGATCGTAAAGGAGTTTATTGCCGAGGTGCGCACGCTCCGTTCTGGATCGTTTCAAA

Full Affymetrix probeset data:

Annotations for 1636433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720