FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636435_at:

>probe:Drosophila_2:1636435_at:120:215; Interrogation_Position=1024; Antisense; AAGAGGCCATCGGATGTGTTCGTCG
>probe:Drosophila_2:1636435_at:660:717; Interrogation_Position=1042; Antisense; TTCGTCGGCGTCTCATGATGTACAA
>probe:Drosophila_2:1636435_at:503:71; Interrogation_Position=1189; Antisense; AGGCTGATTGTTAGTCGTGCTCTTC
>probe:Drosophila_2:1636435_at:274:659; Interrogation_Position=1216; Antisense; TAAGACAACGCAAGCCCCAAGATGT
>probe:Drosophila_2:1636435_at:80:547; Interrogation_Position=692; Antisense; GGAGCCGAATCGTAAATTTTCCAGG
>probe:Drosophila_2:1636435_at:178:17; Interrogation_Position=707; Antisense; ATTTTCCAGGGTATCACCATCATCC
>probe:Drosophila_2:1636435_at:402:545; Interrogation_Position=734; Antisense; TCGACGGATACGTAGTTTTACGCCA
>probe:Drosophila_2:1636435_at:56:329; Interrogation_Position=770; Antisense; GCGTGTTCGATCCATTCAGCAGATT
>probe:Drosophila_2:1636435_at:723:649; Interrogation_Position=785; Antisense; TCAGCAGATTCTGTCAATGGCCAGT
>probe:Drosophila_2:1636435_at:50:565; Interrogation_Position=838; Antisense; GGAATCCGGGTAAATGCAATCGAAC
>probe:Drosophila_2:1636435_at:635:373; Interrogation_Position=882; Antisense; GAAGCCGGCAAATCGCAACCGGATA
>probe:Drosophila_2:1636435_at:219:421; Interrogation_Position=903; Antisense; GATAAACTGCCAACCGGAATTTCCA
>probe:Drosophila_2:1636435_at:118:169; Interrogation_Position=957; Antisense; AAAGGCATCGCCTCCAAGGCAAAGC
>probe:Drosophila_2:1636435_at:211:445; Interrogation_Position=993; Antisense; GATGAGGATCTGCTGTCCTCGAACA

Paste this into a BLAST search page for me
AAGAGGCCATCGGATGTGTTCGTCGTTCGTCGGCGTCTCATGATGTACAAAGGCTGATTGTTAGTCGTGCTCTTCTAAGACAACGCAAGCCCCAAGATGTGGAGCCGAATCGTAAATTTTCCAGGATTTTCCAGGGTATCACCATCATCCTCGACGGATACGTAGTTTTACGCCAGCGTGTTCGATCCATTCAGCAGATTTCAGCAGATTCTGTCAATGGCCAGTGGAATCCGGGTAAATGCAATCGAACGAAGCCGGCAAATCGCAACCGGATAGATAAACTGCCAACCGGAATTTCCAAAAGGCATCGCCTCCAAGGCAAAGCGATGAGGATCTGCTGTCCTCGAACA

Full Affymetrix probeset data:

Annotations for 1636435_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720