FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636436_at:

>probe:Drosophila_2:1636436_at:279:23; Interrogation_Position=1404; Antisense; ATATCAGCAGGAACTGCGGTCACCA
>probe:Drosophila_2:1636436_at:491:623; Interrogation_Position=1418; Antisense; TGCGGTCACCACCATAGCAGCAACA
>probe:Drosophila_2:1636436_at:510:111; Interrogation_Position=1505; Antisense; AGCAAGATCATCAACTGCCGCAGTC
>probe:Drosophila_2:1636436_at:549:625; Interrogation_Position=1520; Antisense; TGCCGCAGTCATTTTCGCCGCAGCA
>probe:Drosophila_2:1636436_at:560:617; Interrogation_Position=1550; Antisense; TGCTACCGCCTTCGCAGCGGCATTA
>probe:Drosophila_2:1636436_at:641:275; Interrogation_Position=1559; Antisense; CTTCGCAGCGGCATTAGCATTAGGA
>probe:Drosophila_2:1636436_at:103:571; Interrogation_Position=1568; Antisense; GGCATTAGCATTAGGAGCAGCAAAT
>probe:Drosophila_2:1636436_at:252:419; Interrogation_Position=1582; Antisense; GAGCAGCAAATTTGGCGGCGGTACC
>probe:Drosophila_2:1636436_at:722:17; Interrogation_Position=1591; Antisense; ATTTGGCGGCGGTACCAAGAGCAAC
>probe:Drosophila_2:1636436_at:111:255; Interrogation_Position=1716; Antisense; CAACTGGCGGATTGGTGGCGAACAT
>probe:Drosophila_2:1636436_at:682:573; Interrogation_Position=1732; Antisense; GGCGAACATGCGATTAATTGTGTGT
>probe:Drosophila_2:1636436_at:351:327; Interrogation_Position=1741; Antisense; GCGATTAATTGTGTGTTTGACCGAA
>probe:Drosophila_2:1636436_at:681:3; Interrogation_Position=1748; Antisense; ATTGTGTGTTTGACCGAACAGAAAC
>probe:Drosophila_2:1636436_at:123:341; Interrogation_Position=1842; Antisense; GCTAGACAGCTACCAACAACAGCAT

Paste this into a BLAST search page for me
ATATCAGCAGGAACTGCGGTCACCATGCGGTCACCACCATAGCAGCAACAAGCAAGATCATCAACTGCCGCAGTCTGCCGCAGTCATTTTCGCCGCAGCATGCTACCGCCTTCGCAGCGGCATTACTTCGCAGCGGCATTAGCATTAGGAGGCATTAGCATTAGGAGCAGCAAATGAGCAGCAAATTTGGCGGCGGTACCATTTGGCGGCGGTACCAAGAGCAACCAACTGGCGGATTGGTGGCGAACATGGCGAACATGCGATTAATTGTGTGTGCGATTAATTGTGTGTTTGACCGAAATTGTGTGTTTGACCGAACAGAAACGCTAGACAGCTACCAACAACAGCAT

Full Affymetrix probeset data:

Annotations for 1636436_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720