Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636437_at:

>probe:Drosophila_2:1636437_at:520:531; Interrogation_Position=1737; Antisense; GGTTTGAGGAGCTCCCACAATGGCA
>probe:Drosophila_2:1636437_at:321:249; Interrogation_Position=1754; Antisense; CAATGGCAGCGATGCCGCTATGCAT
>probe:Drosophila_2:1636437_at:240:683; Interrogation_Position=1772; Antisense; TATGCATCATGCTGCTTCCGTAAAG
>probe:Drosophila_2:1636437_at:378:679; Interrogation_Position=1802; Antisense; TAGTCACACGGAACGAACGCTCCTG
>probe:Drosophila_2:1636437_at:709:235; Interrogation_Position=1944; Antisense; AATCTGGAGTTCGAGCGGGCCAAGC
>probe:Drosophila_2:1636437_at:14:397; Interrogation_Position=1970; Antisense; GAAATTCGATAATCCTCACGGACAG
>probe:Drosophila_2:1636437_at:426:37; Interrogation_Position=2002; Antisense; ATCATCACCAGAGGCAGCGATCCGG
>probe:Drosophila_2:1636437_at:567:195; Interrogation_Position=2028; Antisense; AACGGACGTTATGGCAGCGCAGGCA
>probe:Drosophila_2:1636437_at:652:351; Interrogation_Position=2050; Antisense; GCAGCAGTGCCAGTCGAGCGAATCT
>probe:Drosophila_2:1636437_at:319:113; Interrogation_Position=2109; Antisense; AGCAGCTCCGTTTCCAGTAAGGATG
>probe:Drosophila_2:1636437_at:684:99; Interrogation_Position=2204; Antisense; AGATGGTCTCAAGGTGTCCGACGAT
>probe:Drosophila_2:1636437_at:348:465; Interrogation_Position=2254; Antisense; GATTGTTATCACTTGAACTCCGTAG
>probe:Drosophila_2:1636437_at:419:193; Interrogation_Position=2269; Antisense; AACTCCGTAGCTATGGTTCGACAAG
>probe:Drosophila_2:1636437_at:295:471; Interrogation_Position=2284; Antisense; GTTCGACAAGCTTGCTGCTGGACGA

Paste this into a BLAST search page for me
GGTTTGAGGAGCTCCCACAATGGCACAATGGCAGCGATGCCGCTATGCATTATGCATCATGCTGCTTCCGTAAAGTAGTCACACGGAACGAACGCTCCTGAATCTGGAGTTCGAGCGGGCCAAGCGAAATTCGATAATCCTCACGGACAGATCATCACCAGAGGCAGCGATCCGGAACGGACGTTATGGCAGCGCAGGCAGCAGCAGTGCCAGTCGAGCGAATCTAGCAGCTCCGTTTCCAGTAAGGATGAGATGGTCTCAAGGTGTCCGACGATGATTGTTATCACTTGAACTCCGTAGAACTCCGTAGCTATGGTTCGACAAGGTTCGACAAGCTTGCTGCTGGACGA

Full Affymetrix probeset data:

Annotations for 1636437_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime