FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636439_at:

>probe:Drosophila_2:1636439_at:581:157; Interrogation_Position=374; Antisense; AAAGGCTAACGCACGACCTTTGGCA
>probe:Drosophila_2:1636439_at:609:689; Interrogation_Position=392; Antisense; TTTGGCACCGAGTTCAGATCCTGCG
>probe:Drosophila_2:1636439_at:407:431; Interrogation_Position=498; Antisense; GAGTCCAGCGACCAAAATTCACTCG
>probe:Drosophila_2:1636439_at:500:163; Interrogation_Position=524; Antisense; AAATTATGCTGACCATGTCGACCCT
>probe:Drosophila_2:1636439_at:385:61; Interrogation_Position=538; Antisense; ATGTCGACCCTGATGATGCCAGCAC
>probe:Drosophila_2:1636439_at:498:63; Interrogation_Position=574; Antisense; ATGGGTGCCCCGCAGATCACAATGG
>probe:Drosophila_2:1636439_at:138:455; Interrogation_Position=588; Antisense; GATCACAATGGGTCCGCACAAGCCG
>probe:Drosophila_2:1636439_at:236:159; Interrogation_Position=605; Antisense; ACAAGCCGCCGGAAACGAAGCTGTT
>probe:Drosophila_2:1636439_at:132:353; Interrogation_Position=675; Antisense; GCAGCAGTCGGTGACAGCTGCTCAT
>probe:Drosophila_2:1636439_at:621:283; Interrogation_Position=692; Antisense; CTGCTCATTTGCAGCACAATGGCCA
>probe:Drosophila_2:1636439_at:362:517; Interrogation_Position=787; Antisense; GTGGGCAACAACTCCAAGCCAGGTG
>probe:Drosophila_2:1636439_at:48:613; Interrogation_Position=836; Antisense; TGAATGTCCTTTTCGTCCCGTTTCG
>probe:Drosophila_2:1636439_at:6:639; Interrogation_Position=858; Antisense; TCGGTTCTCGGTCTTGGTCTCGGTT
>probe:Drosophila_2:1636439_at:227:569; Interrogation_Position=903; Antisense; GGCGCAATTTCCACCGGCAAAAGGT

Paste this into a BLAST search page for me
AAAGGCTAACGCACGACCTTTGGCATTTGGCACCGAGTTCAGATCCTGCGGAGTCCAGCGACCAAAATTCACTCGAAATTATGCTGACCATGTCGACCCTATGTCGACCCTGATGATGCCAGCACATGGGTGCCCCGCAGATCACAATGGGATCACAATGGGTCCGCACAAGCCGACAAGCCGCCGGAAACGAAGCTGTTGCAGCAGTCGGTGACAGCTGCTCATCTGCTCATTTGCAGCACAATGGCCAGTGGGCAACAACTCCAAGCCAGGTGTGAATGTCCTTTTCGTCCCGTTTCGTCGGTTCTCGGTCTTGGTCTCGGTTGGCGCAATTTCCACCGGCAAAAGGT

Full Affymetrix probeset data:

Annotations for 1636439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720