Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636440_at:

>probe:Drosophila_2:1636440_at:55:539; Interrogation_Position=1157; Antisense; GGTACAAATGGCATGACCACACCCA
>probe:Drosophila_2:1636440_at:478:127; Interrogation_Position=1199; Antisense; ACCAGTGGCTATAAGGCGGGCACCT
>probe:Drosophila_2:1636440_at:383:525; Interrogation_Position=1216; Antisense; GGGCACCTTGCATTTACCAATGACG
>probe:Drosophila_2:1636440_at:342:395; Interrogation_Position=1247; Antisense; GAAATGCGCGCCAAATTGGCATCCA
>probe:Drosophila_2:1636440_at:15:89; Interrogation_Position=1278; Antisense; AGTACGATCCCAAGAACGAGAGTGT
>probe:Drosophila_2:1636440_at:385:279; Interrogation_Position=1337; Antisense; CTCTGAGACGAAAAGGGTAGCCCAA
>probe:Drosophila_2:1636440_at:295:539; Interrogation_Position=1352; Antisense; GGTAGCCCAACCAACTACTTGTTAT
>probe:Drosophila_2:1636440_at:544:417; Interrogation_Position=1391; Antisense; GAGCTAGAGCTGGTTTTGTCAGGCA
>probe:Drosophila_2:1636440_at:266:477; Interrogation_Position=1403; Antisense; GTTTTGTCAGGCATACACCACACCA
>probe:Drosophila_2:1636440_at:224:543; Interrogation_Position=1538; Antisense; GGATATGATGGAGCACCTACCCTTG
>probe:Drosophila_2:1636440_at:160:419; Interrogation_Position=1548; Antisense; GAGCACCTACCCTTGGAATATCTAT
>probe:Drosophila_2:1636440_at:540:401; Interrogation_Position=1582; Antisense; GACATACGCGTATTCTTCAAATTCA
>probe:Drosophila_2:1636440_at:274:255; Interrogation_Position=1614; Antisense; CAAACTCCGATTGGCAATGTTGCCC
>probe:Drosophila_2:1636440_at:450:231; Interrogation_Position=1629; Antisense; AATGTTGCCCTGGTTCATTGAACAA

Paste this into a BLAST search page for me
GGTACAAATGGCATGACCACACCCAACCAGTGGCTATAAGGCGGGCACCTGGGCACCTTGCATTTACCAATGACGGAAATGCGCGCCAAATTGGCATCCAAGTACGATCCCAAGAACGAGAGTGTCTCTGAGACGAAAAGGGTAGCCCAAGGTAGCCCAACCAACTACTTGTTATGAGCTAGAGCTGGTTTTGTCAGGCAGTTTTGTCAGGCATACACCACACCAGGATATGATGGAGCACCTACCCTTGGAGCACCTACCCTTGGAATATCTATGACATACGCGTATTCTTCAAATTCACAAACTCCGATTGGCAATGTTGCCCAATGTTGCCCTGGTTCATTGAACAA

Full Affymetrix probeset data:

Annotations for 1636440_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime