FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636442_at:

>probe:Drosophila_2:1636442_at:204:407; Interrogation_Position=1001; Antisense; GACTGATTGCGCAACGAGATTCTAT
>probe:Drosophila_2:1636442_at:614:101; Interrogation_Position=518; Antisense; AGAGCCGACATCGTTGCGCAAGCAA
>probe:Drosophila_2:1636442_at:296:361; Interrogation_Position=535; Antisense; GCAAGCAATTCATGCGCAGTCCGGA
>probe:Drosophila_2:1636442_at:271:349; Interrogation_Position=550; Antisense; GCAGTCCGGATGAAATATCCCGTGA
>probe:Drosophila_2:1636442_at:233:75; Interrogation_Position=606; Antisense; AGGACATATAAACGCAACGCCCAGA
>probe:Drosophila_2:1636442_at:73:359; Interrogation_Position=631; Antisense; GCAAACACAGTGTGGCGCGCACAGA
>probe:Drosophila_2:1636442_at:85:101; Interrogation_Position=653; Antisense; AGAGGAGCGGCAATCTTCGGATAAT
>probe:Drosophila_2:1636442_at:677:239; Interrogation_Position=675; Antisense; AATACACGTAATCGCCAGCAACATT
>probe:Drosophila_2:1636442_at:3:437; Interrogation_Position=798; Antisense; GAGGATCAATAATACCGGCCCGAGA
>probe:Drosophila_2:1636442_at:115:669; Interrogation_Position=810; Antisense; TACCGGCCCGAGATCAATAGACTAC
>probe:Drosophila_2:1636442_at:573:663; Interrogation_Position=832; Antisense; TACAGCCTAATTCTCCCAATATATC
>probe:Drosophila_2:1636442_at:443:517; Interrogation_Position=890; Antisense; GTGTGTGTATATCCCAGTCAAGCAG
>probe:Drosophila_2:1636442_at:406:427; Interrogation_Position=914; Antisense; GAGTTGAACTCCTAACAGTGATCCA
>probe:Drosophila_2:1636442_at:460:447; Interrogation_Position=933; Antisense; GATCCAATATCTTAATTCCGTCAAA

Paste this into a BLAST search page for me
GACTGATTGCGCAACGAGATTCTATAGAGCCGACATCGTTGCGCAAGCAAGCAAGCAATTCATGCGCAGTCCGGAGCAGTCCGGATGAAATATCCCGTGAAGGACATATAAACGCAACGCCCAGAGCAAACACAGTGTGGCGCGCACAGAAGAGGAGCGGCAATCTTCGGATAATAATACACGTAATCGCCAGCAACATTGAGGATCAATAATACCGGCCCGAGATACCGGCCCGAGATCAATAGACTACTACAGCCTAATTCTCCCAATATATCGTGTGTGTATATCCCAGTCAAGCAGGAGTTGAACTCCTAACAGTGATCCAGATCCAATATCTTAATTCCGTCAAA

Full Affymetrix probeset data:

Annotations for 1636442_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720