Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636443_s_at:

>probe:Drosophila_2:1636443_s_at:257:137; Interrogation_Position=137; Antisense; ACGAGTCGAATTACTTTCAAGTGCA
>probe:Drosophila_2:1636443_s_at:509:651; Interrogation_Position=153; Antisense; TCAAGTGCAAATAGTGTGCGTGGGC
>probe:Drosophila_2:1636443_s_at:509:691; Interrogation_Position=202; Antisense; TTTGTGCGACTGTGAGTGCGTGTGT
>probe:Drosophila_2:1636443_s_at:462:179; Interrogation_Position=240; Antisense; AAAAACAGAACGTGCAACAAGAAGC
>probe:Drosophila_2:1636443_s_at:116:211; Interrogation_Position=265; Antisense; AAGAAGAAGAGCCATCAGCAGCTGA
>probe:Drosophila_2:1636443_s_at:237:35; Interrogation_Position=278; Antisense; ATCAGCAGCTGACAAACCAGCAATA
>probe:Drosophila_2:1636443_s_at:631:155; Interrogation_Position=322; Antisense; ACAAGTCAATTTAAGAGTGCTATTA
>probe:Drosophila_2:1636443_s_at:253:361; Interrogation_Position=348; Antisense; GAAACTAGAAAAAATGCACCCACGA
>probe:Drosophila_2:1636443_s_at:521:179; Interrogation_Position=358; Antisense; AAAATGCACCCACGATACAGCCCAG
>probe:Drosophila_2:1636443_s_at:73:155; Interrogation_Position=405; Antisense; ACAGATGGGCGGACCGCCACACCAG
>probe:Drosophila_2:1636443_s_at:231:523; Interrogation_Position=469; Antisense; GGGCCATCGAATGCCCAGCAATTGC
>probe:Drosophila_2:1636443_s_at:439:247; Interrogation_Position=487; Antisense; CAATTGCCGCCGCAGATTCCGAGAT
>probe:Drosophila_2:1636443_s_at:110:349; Interrogation_Position=498; Antisense; GCAGATTCCGAGATCCCAGAACTAT
>probe:Drosophila_2:1636443_s_at:464:423; Interrogation_Position=507; Antisense; GAGATCCCAGAACTATTCAAACGTA

Paste this into a BLAST search page for me
ACGAGTCGAATTACTTTCAAGTGCATCAAGTGCAAATAGTGTGCGTGGGCTTTGTGCGACTGTGAGTGCGTGTGTAAAAACAGAACGTGCAACAAGAAGCAAGAAGAAGAGCCATCAGCAGCTGAATCAGCAGCTGACAAACCAGCAATAACAAGTCAATTTAAGAGTGCTATTAGAAACTAGAAAAAATGCACCCACGAAAAATGCACCCACGATACAGCCCAGACAGATGGGCGGACCGCCACACCAGGGGCCATCGAATGCCCAGCAATTGCCAATTGCCGCCGCAGATTCCGAGATGCAGATTCCGAGATCCCAGAACTATGAGATCCCAGAACTATTCAAACGTA

Full Affymetrix probeset data:

Annotations for 1636443_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime