Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636444_at:

>probe:Drosophila_2:1636444_at:696:259; Interrogation_Position=1043; Antisense; CACCATCCAGGGTATTTTCCTTTGG
>probe:Drosophila_2:1636444_at:518:695; Interrogation_Position=1058; Antisense; TTTCCTTTGGAATTCGACCAGCGAG
>probe:Drosophila_2:1636444_at:418:115; Interrogation_Position=1093; Antisense; AGCTTGTACGACTTGGCAGTGGCCA
>probe:Drosophila_2:1636444_at:125:285; Interrogation_Position=1234; Antisense; CTGGAACCTTTTCAGGAGCCTCGAA
>probe:Drosophila_2:1636444_at:326:125; Interrogation_Position=1250; Antisense; AGCCTCGAAAGCCACTGAAGTCCAT
>probe:Drosophila_2:1636444_at:366:413; Interrogation_Position=1285; Antisense; GAGCCTTTTACTCCTTTGGAACCAG
>probe:Drosophila_2:1636444_at:444:729; Interrogation_Position=1300; Antisense; TTGGAACCAGAAACCTCCGACGACA
>probe:Drosophila_2:1636444_at:672:287; Interrogation_Position=1339; Antisense; CTGGAAGCCTTGAGCGTGGTAGTCA
>probe:Drosophila_2:1636444_at:688:589; Interrogation_Position=1355; Antisense; TGGTAGTCAAGCCAATGTCCTCCTT
>probe:Drosophila_2:1636444_at:616:393; Interrogation_Position=1385; Antisense; GAAAGGATTCTCTTAGCTCGTCGCC
>probe:Drosophila_2:1636444_at:250:637; Interrogation_Position=1402; Antisense; TCGTCGCCGCGAGCACAAATGAATG
>probe:Drosophila_2:1636444_at:292:233; Interrogation_Position=1423; Antisense; AATGCTGTTCAATTGGAGGGCACAA
>probe:Drosophila_2:1636444_at:215:445; Interrogation_Position=1453; Antisense; GATGAACTGCATCCAGGCAATACAT
>probe:Drosophila_2:1636444_at:162:333; Interrogation_Position=1548; Antisense; GCTACCCATTGCAGGAGTTTTTTAT

Paste this into a BLAST search page for me
CACCATCCAGGGTATTTTCCTTTGGTTTCCTTTGGAATTCGACCAGCGAGAGCTTGTACGACTTGGCAGTGGCCACTGGAACCTTTTCAGGAGCCTCGAAAGCCTCGAAAGCCACTGAAGTCCATGAGCCTTTTACTCCTTTGGAACCAGTTGGAACCAGAAACCTCCGACGACACTGGAAGCCTTGAGCGTGGTAGTCATGGTAGTCAAGCCAATGTCCTCCTTGAAAGGATTCTCTTAGCTCGTCGCCTCGTCGCCGCGAGCACAAATGAATGAATGCTGTTCAATTGGAGGGCACAAGATGAACTGCATCCAGGCAATACATGCTACCCATTGCAGGAGTTTTTTAT

Full Affymetrix probeset data:

Annotations for 1636444_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime