FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636446_at:

>probe:Drosophila_2:1636446_at:167:77; Interrogation_Position=1001; Antisense; AGGAGGAATTCTACACGCAGTGCAA
>probe:Drosophila_2:1636446_at:267:557; Interrogation_Position=1033; Antisense; GGACTGATTAGCTACCTGGGCACGC
>probe:Drosophila_2:1636446_at:508:523; Interrogation_Position=1065; Antisense; GGGCTGCAATGATATGCACCACTTT
>probe:Drosophila_2:1636446_at:396:655; Interrogation_Position=1101; Antisense; TAATATGCTGTACGACCGCCAGGGA
>probe:Drosophila_2:1636446_at:399:51; Interrogation_Position=1138; Antisense; ATGCGAGGTCTCTACTATTGATATA
>probe:Drosophila_2:1636446_at:227:37; Interrogation_Position=619; Antisense; ATCATGCTACAGCTGAATCCGCTCT
>probe:Drosophila_2:1636446_at:683:377; Interrogation_Position=669; Antisense; GAAGCTATTCGAGTCCCTAATCGAT
>probe:Drosophila_2:1636446_at:292:63; Interrogation_Position=779; Antisense; ATGTGGCGCGCATGACCTCGAACGA
>probe:Drosophila_2:1636446_at:304:725; Interrogation_Position=835; Antisense; TTGGTGGCCCAGGACAGTGCCATTA
>probe:Drosophila_2:1636446_at:633:97; Interrogation_Position=881; Antisense; AGATCGTGCTGCAGTACATACGCGA
>probe:Drosophila_2:1636446_at:406:149; Interrogation_Position=896; Antisense; ACATACGCGATGTGGAGGCCGGAAA
>probe:Drosophila_2:1636446_at:380:335; Interrogation_Position=921; Antisense; GCTGCGGGCCAACCAAGAGATTCTG
>probe:Drosophila_2:1636446_at:116:429; Interrogation_Position=937; Antisense; GAGATTCTGCGAGAAGCCTACGCTC
>probe:Drosophila_2:1636446_at:568:61; Interrogation_Position=986; Antisense; AGGTGCCCGCCTTCCAGGAGGAATT

Paste this into a BLAST search page for me
AGGAGGAATTCTACACGCAGTGCAAGGACTGATTAGCTACCTGGGCACGCGGGCTGCAATGATATGCACCACTTTTAATATGCTGTACGACCGCCAGGGAATGCGAGGTCTCTACTATTGATATAATCATGCTACAGCTGAATCCGCTCTGAAGCTATTCGAGTCCCTAATCGATATGTGGCGCGCATGACCTCGAACGATTGGTGGCCCAGGACAGTGCCATTAAGATCGTGCTGCAGTACATACGCGAACATACGCGATGTGGAGGCCGGAAAGCTGCGGGCCAACCAAGAGATTCTGGAGATTCTGCGAGAAGCCTACGCTCAGGTGCCCGCCTTCCAGGAGGAATT

Full Affymetrix probeset data:

Annotations for 1636446_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720