Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636449_at:

>probe:Drosophila_2:1636449_at:507:467; Interrogation_Position=1209; Antisense; GTTGAGTTCCAATTTCGACATCTAC
>probe:Drosophila_2:1636449_at:492:69; Interrogation_Position=1426; Antisense; ATGGCCGAACTGGTGGTCGATCGCA
>probe:Drosophila_2:1636449_at:143:295; Interrogation_Position=1443; Antisense; CGATCGCATTAACCAATTCCTTCAA
>probe:Drosophila_2:1636449_at:616:365; Interrogation_Position=1482; Antisense; GAATCTATGTAGCAGTCTCACCCTG
>probe:Drosophila_2:1636449_at:171:349; Interrogation_Position=1493; Antisense; GCAGTCTCACCCTGAAGTTAGTCAA
>probe:Drosophila_2:1636449_at:360:89; Interrogation_Position=1508; Antisense; AGTTAGTCAACATCACCGAAGTAAG
>probe:Drosophila_2:1636449_at:122:115; Interrogation_Position=1543; Antisense; AGCGACGAACACGTAAGTCTGGGAA
>probe:Drosophila_2:1636449_at:29:531; Interrogation_Position=1569; Antisense; GGGATTGCGACATTATCATACCAAA
>probe:Drosophila_2:1636449_at:467:313; Interrogation_Position=1627; Antisense; GCCACCGTTCTCTACGACAGAAAAA
>probe:Drosophila_2:1636449_at:532:303; Interrogation_Position=1652; Antisense; CCGAAGAGCTTCAGATCAATGTGGA
>probe:Drosophila_2:1636449_at:220:251; Interrogation_Position=1668; Antisense; CAATGTGGAACTAATCAGCCGAATT
>probe:Drosophila_2:1636449_at:76:655; Interrogation_Position=1692; Antisense; TAATATATACAGACCGGATGCGAGC
>probe:Drosophila_2:1636449_at:657:129; Interrogation_Position=1704; Antisense; ACCGGATGCGAGCTGTTTAGACGAT
>probe:Drosophila_2:1636449_at:311:217; Interrogation_Position=1738; Antisense; AAGTTATTCTGCATATGCCTATCAA

Paste this into a BLAST search page for me
GTTGAGTTCCAATTTCGACATCTACATGGCCGAACTGGTGGTCGATCGCACGATCGCATTAACCAATTCCTTCAAGAATCTATGTAGCAGTCTCACCCTGGCAGTCTCACCCTGAAGTTAGTCAAAGTTAGTCAACATCACCGAAGTAAGAGCGACGAACACGTAAGTCTGGGAAGGGATTGCGACATTATCATACCAAAGCCACCGTTCTCTACGACAGAAAAACCGAAGAGCTTCAGATCAATGTGGACAATGTGGAACTAATCAGCCGAATTTAATATATACAGACCGGATGCGAGCACCGGATGCGAGCTGTTTAGACGATAAGTTATTCTGCATATGCCTATCAA

Full Affymetrix probeset data:

Annotations for 1636449_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime