Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636450_at:

>probe:Drosophila_2:1636450_at:193:667; Interrogation_Position=5139; Antisense; TACACCCATGGTCAGCAGAAGCAAT
>probe:Drosophila_2:1636450_at:616:153; Interrogation_Position=5185; Antisense; ACAGTCATGTCCACACCATTAGCGA
>probe:Drosophila_2:1636450_at:183:157; Interrogation_Position=5197; Antisense; ACACCATTAGCGACGATTTCTGATT
>probe:Drosophila_2:1636450_at:4:461; Interrogation_Position=5211; Antisense; GATTTCTGATTGTTTCGTAGCGCGT
>probe:Drosophila_2:1636450_at:47:639; Interrogation_Position=5225; Antisense; TCGTAGCGCGTTTTCCTTTCGTTGG
>probe:Drosophila_2:1636450_at:317:527; Interrogation_Position=5248; Antisense; GGGAATACCAAACCGCAGAACACTG
>probe:Drosophila_2:1636450_at:250:183; Interrogation_Position=5276; Antisense; AAAATAATTGCTGCCCGTGTGTGTG
>probe:Drosophila_2:1636450_at:598:517; Interrogation_Position=5298; Antisense; GTGTGTGCGGCAGCTTGAATAATGC
>probe:Drosophila_2:1636450_at:177:507; Interrogation_Position=5391; Antisense; GTGCTGTTTTTCGAAACGTTGCCGT
>probe:Drosophila_2:1636450_at:183:197; Interrogation_Position=5405; Antisense; AACGTTGCCGTAGTGTGTAATTTTG
>probe:Drosophila_2:1636450_at:672:599; Interrogation_Position=5420; Antisense; TGTAATTTTGTTGCCTGCCCAGAGA
>probe:Drosophila_2:1636450_at:139:495; Interrogation_Position=5537; Antisense; GTAATTGATTTTGTGCATGCCCCAA
>probe:Drosophila_2:1636450_at:169:597; Interrogation_Position=5548; Antisense; TGTGCATGCCCCAAAACTAATCAAT
>probe:Drosophila_2:1636450_at:611:601; Interrogation_Position=5579; Antisense; TGTTTGCTTCTCTTTTTTCTTCCAC

Paste this into a BLAST search page for me
TACACCCATGGTCAGCAGAAGCAATACAGTCATGTCCACACCATTAGCGAACACCATTAGCGACGATTTCTGATTGATTTCTGATTGTTTCGTAGCGCGTTCGTAGCGCGTTTTCCTTTCGTTGGGGGAATACCAAACCGCAGAACACTGAAAATAATTGCTGCCCGTGTGTGTGGTGTGTGCGGCAGCTTGAATAATGCGTGCTGTTTTTCGAAACGTTGCCGTAACGTTGCCGTAGTGTGTAATTTTGTGTAATTTTGTTGCCTGCCCAGAGAGTAATTGATTTTGTGCATGCCCCAATGTGCATGCCCCAAAACTAATCAATTGTTTGCTTCTCTTTTTTCTTCCAC

Full Affymetrix probeset data:

Annotations for 1636450_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime