Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636452_at:

>probe:Drosophila_2:1636452_at:19:377; Interrogation_Position=1005; Antisense; GAAGAATCGTCGCAATCGCAACAAG
>probe:Drosophila_2:1636452_at:332:43; Interrogation_Position=1019; Antisense; ATCGCAACAAGAACCGTCGCAATCG
>probe:Drosophila_2:1636452_at:28:35; Interrogation_Position=1045; Antisense; ATCACCGCCGTCTAAGGATCTAGGA
>probe:Drosophila_2:1636452_at:104:463; Interrogation_Position=1068; Antisense; GATTCAAGGTCAGGATCCAACGATC
>probe:Drosophila_2:1636452_at:474:449; Interrogation_Position=1089; Antisense; GATCCGACACATTCCGGCAAGATAA
>probe:Drosophila_2:1636452_at:363:601; Interrogation_Position=1132; Antisense; TGTAGCCTAACTTGCTACTGCCACA
>probe:Drosophila_2:1636452_at:517:385; Interrogation_Position=619; Antisense; GAACAGGACCAGGAGCTGGCCCAAC
>probe:Drosophila_2:1636452_at:721:671; Interrogation_Position=655; Antisense; TACCCCGCCGAGTTGATGGACGAGC
>probe:Drosophila_2:1636452_at:555:533; Interrogation_Position=723; Antisense; GGTGGTCACCACTGAGCACGAGGTC
>probe:Drosophila_2:1636452_at:624:31; Interrogation_Position=797; Antisense; ATAACCATATCAGTCTGCGACGCAA
>probe:Drosophila_2:1636452_at:1:331; Interrogation_Position=833; Antisense; GCGGCCAGGTGATCAGCGTTCGCAT
>probe:Drosophila_2:1636452_at:582:383; Interrogation_Position=885; Antisense; GAACGGCCAGAAGGTGATGCTCAAT
>probe:Drosophila_2:1636452_at:517:605; Interrogation_Position=899; Antisense; TGATGCTCAATACCGGTAGTCGTCC
>probe:Drosophila_2:1636452_at:96:717; Interrogation_Position=944; Antisense; TTCGCAAGCGAGTGCCTGCCAAGAA

Paste this into a BLAST search page for me
GAAGAATCGTCGCAATCGCAACAAGATCGCAACAAGAACCGTCGCAATCGATCACCGCCGTCTAAGGATCTAGGAGATTCAAGGTCAGGATCCAACGATCGATCCGACACATTCCGGCAAGATAATGTAGCCTAACTTGCTACTGCCACAGAACAGGACCAGGAGCTGGCCCAACTACCCCGCCGAGTTGATGGACGAGCGGTGGTCACCACTGAGCACGAGGTCATAACCATATCAGTCTGCGACGCAAGCGGCCAGGTGATCAGCGTTCGCATGAACGGCCAGAAGGTGATGCTCAATTGATGCTCAATACCGGTAGTCGTCCTTCGCAAGCGAGTGCCTGCCAAGAA

Full Affymetrix probeset data:

Annotations for 1636452_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime