FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636453_at:

>probe:Drosophila_2:1636453_at:445:613; Interrogation_Position=1013; Antisense; TGAAGTTCCCGGACGCCATAAATCA
>probe:Drosophila_2:1636453_at:176:165; Interrogation_Position=1032; Antisense; AAATCACCAGAATTTCCCGTCAATC
>probe:Drosophila_2:1636453_at:694:235; Interrogation_Position=580; Antisense; AATCTCTCGAACCATGCCTATTTTA
>probe:Drosophila_2:1636453_at:403:313; Interrogation_Position=595; Antisense; GCCTATTTTAATCTAGCTGGCCATA
>probe:Drosophila_2:1636453_at:695:397; Interrogation_Position=724; Antisense; GACAACACGGCTTATGATCTCAGGT
>probe:Drosophila_2:1636453_at:618:79; Interrogation_Position=745; Antisense; AGGTCACCTGTGGTCCTGGGAGATC
>probe:Drosophila_2:1636453_at:630:593; Interrogation_Position=761; Antisense; TGGGAGATCGCCTCAAGCAGTTTGA
>probe:Drosophila_2:1636453_at:195:107; Interrogation_Position=785; Antisense; AGAACTGTCCGATCCAGGGTTTCGA
>probe:Drosophila_2:1636453_at:219:479; Interrogation_Position=803; Antisense; GTTTCGACAACTGCTATGTGGTCAA
>probe:Drosophila_2:1636453_at:52:495; Interrogation_Position=833; Antisense; GTCAGCTGTTGAGATCTACCGTCAA
>probe:Drosophila_2:1636453_at:565:215; Interrogation_Position=865; Antisense; AAGATAGTGCATCCGCCAAGTGGTC
>probe:Drosophila_2:1636453_at:302:239; Interrogation_Position=910; Antisense; AATCAGCCAGGCATTCAGTTCTATA
>probe:Drosophila_2:1636453_at:95:699; Interrogation_Position=976; Antisense; TTTTATGTGAAACACGGCGCCCTTT
>probe:Drosophila_2:1636453_at:390:321; Interrogation_Position=992; Antisense; GCGCCCTTTGCGTTCAAACGGTGAA

Paste this into a BLAST search page for me
TGAAGTTCCCGGACGCCATAAATCAAAATCACCAGAATTTCCCGTCAATCAATCTCTCGAACCATGCCTATTTTAGCCTATTTTAATCTAGCTGGCCATAGACAACACGGCTTATGATCTCAGGTAGGTCACCTGTGGTCCTGGGAGATCTGGGAGATCGCCTCAAGCAGTTTGAAGAACTGTCCGATCCAGGGTTTCGAGTTTCGACAACTGCTATGTGGTCAAGTCAGCTGTTGAGATCTACCGTCAAAAGATAGTGCATCCGCCAAGTGGTCAATCAGCCAGGCATTCAGTTCTATATTTTATGTGAAACACGGCGCCCTTTGCGCCCTTTGCGTTCAAACGGTGAA

Full Affymetrix probeset data:

Annotations for 1636453_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720