FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636454_at:

>probe:Drosophila_2:1636454_at:276:591; Interrogation_Position=3205; Antisense; TGGTCAGTTTTATTCCTCAAGCTCA
>probe:Drosophila_2:1636454_at:31:295; Interrogation_Position=3241; Antisense; CGACCCTTCTATACGTTCAATGTTT
>probe:Drosophila_2:1636454_at:530:179; Interrogation_Position=3315; Antisense; AAAAACAACAGTGCCTGCTCCATAC
>probe:Drosophila_2:1636454_at:444:27; Interrogation_Position=3336; Antisense; ATACCACATACACTCAGGCTGTTTC
>probe:Drosophila_2:1636454_at:472:333; Interrogation_Position=3353; Antisense; GCTGTTTCTGGCCAAAAATCGCTCA
>probe:Drosophila_2:1636454_at:584:159; Interrogation_Position=3396; Antisense; AAAGCTAAGCCGTGTTTGTACTGTA
>probe:Drosophila_2:1636454_at:357:599; Interrogation_Position=3417; Antisense; TGTAACGCGTTTTCAGTACGTCCGC
>probe:Drosophila_2:1636454_at:101:649; Interrogation_Position=3472; Antisense; TCACCCGGAAGCCAACAAGCTGAAG
>probe:Drosophila_2:1636454_at:300:119; Interrogation_Position=3489; Antisense; AGCTGAAGCAGCTTACTAGCCCGCT
>probe:Drosophila_2:1636454_at:155:377; Interrogation_Position=3529; Antisense; GAACATTGGCTTGAACTTGGACCCC
>probe:Drosophila_2:1636454_at:199:95; Interrogation_Position=3558; Antisense; AGATAGCCACCAAGACCGGAGTCCT
>probe:Drosophila_2:1636454_at:376:651; Interrogation_Position=3635; Antisense; TCACGGGATCACTTGCTGGAGCTGT
>probe:Drosophila_2:1636454_at:541:657; Interrogation_Position=3698; Antisense; TAAGAAGGTCACTAGGCGGGCAATA
>probe:Drosophila_2:1636454_at:455:25; Interrogation_Position=3720; Antisense; ATAGCCGAAGCTACACACTTTTTAA

Paste this into a BLAST search page for me
TGGTCAGTTTTATTCCTCAAGCTCACGACCCTTCTATACGTTCAATGTTTAAAAACAACAGTGCCTGCTCCATACATACCACATACACTCAGGCTGTTTCGCTGTTTCTGGCCAAAAATCGCTCAAAAGCTAAGCCGTGTTTGTACTGTATGTAACGCGTTTTCAGTACGTCCGCTCACCCGGAAGCCAACAAGCTGAAGAGCTGAAGCAGCTTACTAGCCCGCTGAACATTGGCTTGAACTTGGACCCCAGATAGCCACCAAGACCGGAGTCCTTCACGGGATCACTTGCTGGAGCTGTTAAGAAGGTCACTAGGCGGGCAATAATAGCCGAAGCTACACACTTTTTAA

Full Affymetrix probeset data:

Annotations for 1636454_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720