FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636456_at:

>probe:Drosophila_2:1636456_at:365:203; Interrogation_Position=107; Antisense; AAGCCGCTGGTCTCCTTCGGTGTCA
>probe:Drosophila_2:1636456_at:641:639; Interrogation_Position=123; Antisense; TCGGTGTCAGCTACCAGCAGCCTTA
>probe:Drosophila_2:1636456_at:185:127; Interrogation_Position=159; Antisense; AGCCAGAATCCTACTACTACGGAGG
>probe:Drosophila_2:1636456_at:562:405; Interrogation_Position=18; Antisense; GACGGCGTAGTTTGCAGTTTGAACA
>probe:Drosophila_2:1636456_at:182:539; Interrogation_Position=186; Antisense; GGTACCCGGCTGGTGGCTACTACAA
>probe:Drosophila_2:1636456_at:387:573; Interrogation_Position=193; Antisense; GGCTGGTGGCTACTACAACAACTAC
>probe:Drosophila_2:1636456_at:437:47; Interrogation_Position=249; Antisense; ATCCGTATGCCAATCGCTATGGTGC
>probe:Drosophila_2:1636456_at:543:681; Interrogation_Position=266; Antisense; TATGGTGCCCTCGATCTCGGAATCG
>probe:Drosophila_2:1636456_at:334:565; Interrogation_Position=284; Antisense; GGAATCGGCGCCCTGTCGCTATCGT
>probe:Drosophila_2:1636456_at:674:469; Interrogation_Position=310; Antisense; GTTCCTGCTCTGATTCCGTATAAAA
>probe:Drosophila_2:1636456_at:54:463; Interrogation_Position=321; Antisense; GATTCCGTATAAAAGCCAAAAGCCA
>probe:Drosophila_2:1636456_at:115:205; Interrogation_Position=340; Antisense; AAGCCACAGCAAATAGATGCGCAAA
>probe:Drosophila_2:1636456_at:76:387; Interrogation_Position=43; Antisense; GAAAATGCGCAATTATCTCTGGTTA
>probe:Drosophila_2:1636456_at:92:705; Interrogation_Position=55; Antisense; TTATCTCTGGTTAGCAGTGCTCCTG

Paste this into a BLAST search page for me
AAGCCGCTGGTCTCCTTCGGTGTCATCGGTGTCAGCTACCAGCAGCCTTAAGCCAGAATCCTACTACTACGGAGGGACGGCGTAGTTTGCAGTTTGAACAGGTACCCGGCTGGTGGCTACTACAAGGCTGGTGGCTACTACAACAACTACATCCGTATGCCAATCGCTATGGTGCTATGGTGCCCTCGATCTCGGAATCGGGAATCGGCGCCCTGTCGCTATCGTGTTCCTGCTCTGATTCCGTATAAAAGATTCCGTATAAAAGCCAAAAGCCAAAGCCACAGCAAATAGATGCGCAAAGAAAATGCGCAATTATCTCTGGTTATTATCTCTGGTTAGCAGTGCTCCTG

Full Affymetrix probeset data:

Annotations for 1636456_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720