FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636457_at:

>probe:Drosophila_2:1636457_at:450:93; Interrogation_Position=104; Antisense; AGATCTTCAAAGAGGCCGCCAGTTT
>probe:Drosophila_2:1636457_at:669:729; Interrogation_Position=181; Antisense; TTGGTCTTCATGGTGGTGGCTCTAA
>probe:Drosophila_2:1636457_at:166:339; Interrogation_Position=199; Antisense; GCTCTAATGGTGGTCGGTTTCATCA
>probe:Drosophila_2:1636457_at:80:473; Interrogation_Position=20; Antisense; GTTCTCTATCCGTGCTGATGTTCAA
>probe:Drosophila_2:1636457_at:377:537; Interrogation_Position=214; Antisense; GGTTTCATCATGTACGATCGCATTA
>probe:Drosophila_2:1636457_at:561:391; Interrogation_Position=311; Antisense; GAAAGCCCAAAACATCCGATTCTCT
>probe:Drosophila_2:1636457_at:295:481; Interrogation_Position=386; Antisense; GTATCAGCGTGGCACATTCCGAATA
>probe:Drosophila_2:1636457_at:649:97; Interrogation_Position=417; Antisense; AGATGACGATGTCGCAACCCTTCAA
>probe:Drosophila_2:1636457_at:146:201; Interrogation_Position=432; Antisense; AACCCTTCAACCCATTGACGATGAA
>probe:Drosophila_2:1636457_at:178:219; Interrogation_Position=467; Antisense; AAGTCGCAATGTTCGGAACTCCCAA
>probe:Drosophila_2:1636457_at:82:65; Interrogation_Position=548; Antisense; ATGGGTACTTCCGTAGATTGCATCT
>probe:Drosophila_2:1636457_at:195:463; Interrogation_Position=563; Antisense; GATTGCATCTACACGTCACACATTG
>probe:Drosophila_2:1636457_at:4:399; Interrogation_Position=60; Antisense; GACAAATCTCTTTGGCATGGCCGAC
>probe:Drosophila_2:1636457_at:515:569; Interrogation_Position=73; Antisense; GGCATGGCCGACGATGTGTACAATA

Paste this into a BLAST search page for me
AGATCTTCAAAGAGGCCGCCAGTTTTTGGTCTTCATGGTGGTGGCTCTAAGCTCTAATGGTGGTCGGTTTCATCAGTTCTCTATCCGTGCTGATGTTCAAGGTTTCATCATGTACGATCGCATTAGAAAGCCCAAAACATCCGATTCTCTGTATCAGCGTGGCACATTCCGAATAAGATGACGATGTCGCAACCCTTCAAAACCCTTCAACCCATTGACGATGAAAAGTCGCAATGTTCGGAACTCCCAAATGGGTACTTCCGTAGATTGCATCTGATTGCATCTACACGTCACACATTGGACAAATCTCTTTGGCATGGCCGACGGCATGGCCGACGATGTGTACAATA

Full Affymetrix probeset data:

Annotations for 1636457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720