FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636458_at:

>probe:Drosophila_2:1636458_at:344:269; Interrogation_Position=1010; Antisense; CATGTGCGACGCCAATACGGAGTGC
>probe:Drosophila_2:1636458_at:335:347; Interrogation_Position=1057; Antisense; GCATCTTCTGCCAGCTGGGATCTTA
>probe:Drosophila_2:1636458_at:513:529; Interrogation_Position=1073; Antisense; GGGATCTTATGCCACCAGCTATGTC
>probe:Drosophila_2:1636458_at:135:355; Interrogation_Position=1105; Antisense; GCACCAGTGGCAGCAACTTCGAGGA
>probe:Drosophila_2:1636458_at:161:453; Interrogation_Position=1178; Antisense; GATCTATCTGGAGTGCAACGAGGTC
>probe:Drosophila_2:1636458_at:498:195; Interrogation_Position=1194; Antisense; AACGAGGTCTAGACTTCCCAGTGGC
>probe:Drosophila_2:1636458_at:387:53; Interrogation_Position=1258; Antisense; ATGACTTCCCTAGATGTTAGCTATT
>probe:Drosophila_2:1636458_at:277:165; Interrogation_Position=1300; Antisense; AAATCTGTACTTATGGTCGCCGTAA
>probe:Drosophila_2:1636458_at:676:233; Interrogation_Position=1325; Antisense; AATGCGACTGGCTTCTAAGTTGACA
>probe:Drosophila_2:1636458_at:447:79; Interrogation_Position=799; Antisense; AGGTCGACAACGGTGGATCTCCCAT
>probe:Drosophila_2:1636458_at:180:451; Interrogation_Position=814; Antisense; GATCTCCCATGCAGTTCATTCAGAT
>probe:Drosophila_2:1636458_at:477:55; Interrogation_Position=843; Antisense; ATGAACCTGCTGGACGCCCTGAAGA
>probe:Drosophila_2:1636458_at:180:39; Interrogation_Position=945; Antisense; ATCTCGCTGATGAAGGGCTACGTCC
>probe:Drosophila_2:1636458_at:583:379; Interrogation_Position=970; Antisense; GAACCTATCGCACCTCGGAGGACAA

Paste this into a BLAST search page for me
CATGTGCGACGCCAATACGGAGTGCGCATCTTCTGCCAGCTGGGATCTTAGGGATCTTATGCCACCAGCTATGTCGCACCAGTGGCAGCAACTTCGAGGAGATCTATCTGGAGTGCAACGAGGTCAACGAGGTCTAGACTTCCCAGTGGCATGACTTCCCTAGATGTTAGCTATTAAATCTGTACTTATGGTCGCCGTAAAATGCGACTGGCTTCTAAGTTGACAAGGTCGACAACGGTGGATCTCCCATGATCTCCCATGCAGTTCATTCAGATATGAACCTGCTGGACGCCCTGAAGAATCTCGCTGATGAAGGGCTACGTCCGAACCTATCGCACCTCGGAGGACAA

Full Affymetrix probeset data:

Annotations for 1636458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720