FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636460_at:

>probe:Drosophila_2:1636460_at:12:205; Interrogation_Position=260; Antisense; AAGCATTGTACCGATGGCATGGAAT
>probe:Drosophila_2:1636460_at:523:569; Interrogation_Position=275; Antisense; GGCATGGAATCGGTGACCATCTACT
>probe:Drosophila_2:1636460_at:410:641; Interrogation_Position=309; Antisense; TCTGGCGCCTGCAGGCACAGTACAC
>probe:Drosophila_2:1636460_at:524:141; Interrogation_Position=336; Antisense; ACTGGGTGGGACGTAGCGACTTCAT
>probe:Drosophila_2:1636460_at:504:121; Interrogation_Position=350; Antisense; AGCGACTTCATTGAGCACGGATCTG
>probe:Drosophila_2:1636460_at:231:141; Interrogation_Position=366; Antisense; ACGGATCTGGAGACATCTCCCTCAT
>probe:Drosophila_2:1636460_at:13:633; Interrogation_Position=438; Antisense; TCCCCAGGTACGACGATCGCTACAA
>probe:Drosophila_2:1636460_at:322:191; Interrogation_Position=464; Antisense; AACTACCAAGGCTGGTGGGCTCTGG
>probe:Drosophila_2:1636460_at:410:209; Interrogation_Position=503; Antisense; AAGACCTCCGATGAGGGCGGTGTCT
>probe:Drosophila_2:1636460_at:182:57; Interrogation_Position=513; Antisense; ATGAGGGCGGTGTCTCCGAGTACCT
>probe:Drosophila_2:1636460_at:209:501; Interrogation_Position=545; Antisense; GTCGATGTCCAGATTGGCGAAAACT
>probe:Drosophila_2:1636460_at:545:575; Interrogation_Position=560; Antisense; GGCGAAAACTCCGTGTGCGAGAACT
>probe:Drosophila_2:1636460_at:328:507; Interrogation_Position=574; Antisense; GTGCGAGAACTACTACGGCAGCTTC
>probe:Drosophila_2:1636460_at:253:499; Interrogation_Position=741; Antisense; GTCCCAAGGGTATGGTGCGCGTCAC

Paste this into a BLAST search page for me
AAGCATTGTACCGATGGCATGGAATGGCATGGAATCGGTGACCATCTACTTCTGGCGCCTGCAGGCACAGTACACACTGGGTGGGACGTAGCGACTTCATAGCGACTTCATTGAGCACGGATCTGACGGATCTGGAGACATCTCCCTCATTCCCCAGGTACGACGATCGCTACAAAACTACCAAGGCTGGTGGGCTCTGGAAGACCTCCGATGAGGGCGGTGTCTATGAGGGCGGTGTCTCCGAGTACCTGTCGATGTCCAGATTGGCGAAAACTGGCGAAAACTCCGTGTGCGAGAACTGTGCGAGAACTACTACGGCAGCTTCGTCCCAAGGGTATGGTGCGCGTCAC

Full Affymetrix probeset data:

Annotations for 1636460_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720