FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636461_at:

>probe:Drosophila_2:1636461_at:657:25; Interrogation_Position=1359; Antisense; ATAGTCACAGAAGCACCATCCACAG
>probe:Drosophila_2:1636461_at:63:73; Interrogation_Position=1420; Antisense; AGGAAGCACCCGCTGCAGTTGCACC
>probe:Drosophila_2:1636461_at:616:567; Interrogation_Position=1445; Antisense; GGCAGGACCTGCTGATGACTTACCC
>probe:Drosophila_2:1636461_at:52:335; Interrogation_Position=1455; Antisense; GCTGATGACTTACCCACAATTGTGA
>probe:Drosophila_2:1636461_at:620:247; Interrogation_Position=1472; Antisense; AATTGTGATTGAAGCCACCGCCGAG
>probe:Drosophila_2:1636461_at:407:91; Interrogation_Position=1495; Antisense; AGTTTGTACGCACCGTCAGCGTGGA
>probe:Drosophila_2:1636461_at:112:203; Interrogation_Position=1579; Antisense; AACCAGAGTCGACGCCCGCTTAAGG
>probe:Drosophila_2:1636461_at:593:141; Interrogation_Position=1594; Antisense; CCGCTTAAGGCGGAACAGGGAGCTT
>probe:Drosophila_2:1636461_at:261:661; Interrogation_Position=1660; Antisense; TAAAAGGAACTCTCGCAACTACTAA
>probe:Drosophila_2:1636461_at:185:635; Interrogation_Position=1672; Antisense; TCGCAACTACTAAAGCGGCAGCTTT
>probe:Drosophila_2:1636461_at:419:597; Interrogation_Position=1701; Antisense; TGCAGTAGTTTAGTTTACGGCGTAC
>probe:Drosophila_2:1636461_at:20:65; Interrogation_Position=1814; Antisense; ATGGACGACCAAAGGAGCCAGTTTC
>probe:Drosophila_2:1636461_at:513:415; Interrogation_Position=1828; Antisense; GAGCCAGTTTCCTCAATTTGTTAAC
>probe:Drosophila_2:1636461_at:442:667; Interrogation_Position=1874; Antisense; TACGGTTTCCCACTCACAAAAGTTG

Paste this into a BLAST search page for me
ATAGTCACAGAAGCACCATCCACAGAGGAAGCACCCGCTGCAGTTGCACCGGCAGGACCTGCTGATGACTTACCCGCTGATGACTTACCCACAATTGTGAAATTGTGATTGAAGCCACCGCCGAGAGTTTGTACGCACCGTCAGCGTGGAAACCAGAGTCGACGCCCGCTTAAGGCCGCTTAAGGCGGAACAGGGAGCTTTAAAAGGAACTCTCGCAACTACTAATCGCAACTACTAAAGCGGCAGCTTTTGCAGTAGTTTAGTTTACGGCGTACATGGACGACCAAAGGAGCCAGTTTCGAGCCAGTTTCCTCAATTTGTTAACTACGGTTTCCCACTCACAAAAGTTG

Full Affymetrix probeset data:

Annotations for 1636461_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720