Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636464_at:

>probe:Drosophila_2:1636464_at:302:73; Interrogation_Position=2355; Antisense; AGGCAATTGTGTCCAGCAGCCCCAA
>probe:Drosophila_2:1636464_at:415:189; Interrogation_Position=2391; Antisense; AACATTAAGCTGGAGGCACACGCCA
>probe:Drosophila_2:1636464_at:455:631; Interrogation_Position=2442; Antisense; TCCGTCCCGCTGAAGGAACAACTGA
>probe:Drosophila_2:1636464_at:353:359; Interrogation_Position=2470; Antisense; GCAAGCACCCACAAGCGAACGTGAA
>probe:Drosophila_2:1636464_at:141:189; Interrogation_Position=2495; Antisense; AACAGATCCGGAACAGCAGCCGACT
>probe:Drosophila_2:1636464_at:287:421; Interrogation_Position=2544; Antisense; GAGAATTCACAAACCAAACCGCCGG
>probe:Drosophila_2:1636464_at:514:435; Interrogation_Position=2622; Antisense; GAGGTCGTTGAGGTTCCTATCGAAA
>probe:Drosophila_2:1636464_at:624:169; Interrogation_Position=2644; Antisense; AAAGGCAAGCCACAGAGCCACCGAA
>probe:Drosophila_2:1636464_at:269:721; Interrogation_Position=2712; Antisense; TTCCAGCGCGGATTCAAGGCCAAGA
>probe:Drosophila_2:1636464_at:147:111; Interrogation_Position=2734; Antisense; AGAATCGAGGAAACCACCCGCAGAG
>probe:Drosophila_2:1636464_at:232:351; Interrogation_Position=2753; Antisense; GCAGAGCTCCAGTCAGCAGGTTCCG
>probe:Drosophila_2:1636464_at:140:347; Interrogation_Position=2768; Antisense; GCAGGTTCCGCAGCACAAGGGTACA
>probe:Drosophila_2:1636464_at:255:223; Interrogation_Position=2784; Antisense; AAGGGTACAGGCAACTTTGACTACA
>probe:Drosophila_2:1636464_at:110:383; Interrogation_Position=2810; Antisense; GAACGTGGACTTCCGGCAATTCAAG

Paste this into a BLAST search page for me
AGGCAATTGTGTCCAGCAGCCCCAAAACATTAAGCTGGAGGCACACGCCATCCGTCCCGCTGAAGGAACAACTGAGCAAGCACCCACAAGCGAACGTGAAAACAGATCCGGAACAGCAGCCGACTGAGAATTCACAAACCAAACCGCCGGGAGGTCGTTGAGGTTCCTATCGAAAAAAGGCAAGCCACAGAGCCACCGAATTCCAGCGCGGATTCAAGGCCAAGAAGAATCGAGGAAACCACCCGCAGAGGCAGAGCTCCAGTCAGCAGGTTCCGGCAGGTTCCGCAGCACAAGGGTACAAAGGGTACAGGCAACTTTGACTACAGAACGTGGACTTCCGGCAATTCAAG

Full Affymetrix probeset data:

Annotations for 1636464_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime