FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636465_at:

>probe:Drosophila_2:1636465_at:189:209; Interrogation_Position=1359; Antisense; AAGCAGTTCCAGTGCACGCAGTGCG
>probe:Drosophila_2:1636465_at:12:137; Interrogation_Position=1374; Antisense; ACGCAGTGCGACAAGGGTTTCACCA
>probe:Drosophila_2:1636465_at:702:211; Interrogation_Position=1401; Antisense; AAGACCTATCTGTCGGCTCATATGG
>probe:Drosophila_2:1636465_at:120:25; Interrogation_Position=1420; Antisense; ATATGGAACAGCACCGAGGCTCGGG
>probe:Drosophila_2:1636465_at:279:197; Interrogation_Position=1446; Antisense; AACGGCGAGGCATCGGTCGCATCAT
>probe:Drosophila_2:1636465_at:691:445; Interrogation_Position=1479; Antisense; GATGCATCCAGTCGCAACCAGAATG
>probe:Drosophila_2:1636465_at:726:365; Interrogation_Position=1499; Antisense; GAATGCCTCCGCACGGAAGGAGTCA
>probe:Drosophila_2:1636465_at:44:697; Interrogation_Position=1555; Antisense; TTTCGCTGGACTCCGTAGAGCTGGA
>probe:Drosophila_2:1636465_at:472:249; Interrogation_Position=1658; Antisense; CAATGACCGCGAAGGGCTGCAGCAT
>probe:Drosophila_2:1636465_at:187:83; Interrogation_Position=1670; Antisense; AGGGCTGCAGCATGACGATTCCTAC
>probe:Drosophila_2:1636465_at:291:139; Interrogation_Position=1699; Antisense; ACGTCGGTGGCTACCAGAGCGTTGA
>probe:Drosophila_2:1636465_at:425:493; Interrogation_Position=1728; Antisense; GTCAAGGAACTGGTCGGCGATCTGC
>probe:Drosophila_2:1636465_at:58:399; Interrogation_Position=1755; Antisense; GACACCGAGGAGTTCTGTGACGAAT
>probe:Drosophila_2:1636465_at:155:525; Interrogation_Position=1834; Antisense; GGGCTGTCTCCACACAAGGATGGCC

Paste this into a BLAST search page for me
AAGCAGTTCCAGTGCACGCAGTGCGACGCAGTGCGACAAGGGTTTCACCAAAGACCTATCTGTCGGCTCATATGGATATGGAACAGCACCGAGGCTCGGGAACGGCGAGGCATCGGTCGCATCATGATGCATCCAGTCGCAACCAGAATGGAATGCCTCCGCACGGAAGGAGTCATTTCGCTGGACTCCGTAGAGCTGGACAATGACCGCGAAGGGCTGCAGCATAGGGCTGCAGCATGACGATTCCTACACGTCGGTGGCTACCAGAGCGTTGAGTCAAGGAACTGGTCGGCGATCTGCGACACCGAGGAGTTCTGTGACGAATGGGCTGTCTCCACACAAGGATGGCC

Full Affymetrix probeset data:

Annotations for 1636465_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720