Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636466_s_at:

>probe:Drosophila_2:1636466_s_at:636:189; Interrogation_Position=245; Antisense; AACATCGAGAAGGACATCGCCGCCT
>probe:Drosophila_2:1636466_s_at:176:717; Interrogation_Position=332; Antisense; TTCGGATCCTATGTGACCCACGAGA
>probe:Drosophila_2:1636466_s_at:99:713; Interrogation_Position=365; Antisense; TTCATCTATTTCTACCTGGGCCAGG
>probe:Drosophila_2:1636466_s_at:569:81; Interrogation_Position=387; Antisense; AGGTGGCCATTCTGCTCTTCAAGAG
>probe:Drosophila_2:1636466_s_at:451:709; Interrogation_Position=415; Antisense; TTAAACGCATCTCGACGCCTGATAG
>probe:Drosophila_2:1636466_s_at:630:569; Interrogation_Position=451; Antisense; TGGCGCCCACCAAAGTTTTCCGGAG
>probe:Drosophila_2:1636466_s_at:610:547; Interrogation_Position=472; Antisense; GGAGGAGTCGCCAAACACTATTGTT
>probe:Drosophila_2:1636466_s_at:443:193; Interrogation_Position=509; Antisense; AACTCATGCACACTTACGAATCCAC
>probe:Drosophila_2:1636466_s_at:312:157; Interrogation_Position=538; Antisense; ACACATACGCACTGCACTGCATTGA
>probe:Drosophila_2:1636466_s_at:700:143; Interrogation_Position=553; Antisense; ACTGCATTGACACACGCACACTTGA
>probe:Drosophila_2:1636466_s_at:452:609; Interrogation_Position=575; Antisense; TGACCTCGCGTTGATTCGTTTTTTC
>probe:Drosophila_2:1636466_s_at:57:183; Interrogation_Position=610; Antisense; AAAACTTCGCTGTGCTGACTTAGCC
>probe:Drosophila_2:1636466_s_at:454:673; Interrogation_Position=630; Antisense; TAGCCACTCTGCTGCCAAATAAATC
>probe:Drosophila_2:1636466_s_at:593:651; Interrogation_Position=653; Antisense; TCAAATACTGGTCCTGACTTCACTA

Paste this into a BLAST search page for me
AACATCGAGAAGGACATCGCCGCCTTTCGGATCCTATGTGACCCACGAGATTCATCTATTTCTACCTGGGCCAGGAGGTGGCCATTCTGCTCTTCAAGAGTTAAACGCATCTCGACGCCTGATAGTGGCGCCCACCAAAGTTTTCCGGAGGGAGGAGTCGCCAAACACTATTGTTAACTCATGCACACTTACGAATCCACACACATACGCACTGCACTGCATTGAACTGCATTGACACACGCACACTTGATGACCTCGCGTTGATTCGTTTTTTCAAAACTTCGCTGTGCTGACTTAGCCTAGCCACTCTGCTGCCAAATAAATCTCAAATACTGGTCCTGACTTCACTA

Full Affymetrix probeset data:

Annotations for 1636466_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime