Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636470_at:

>probe:Drosophila_2:1636470_at:151:249; Interrogation_Position=148; Antisense; CAATTGGCAAAGGATACGGTTTCGA
>probe:Drosophila_2:1636470_at:145:633; Interrogation_Position=169; Antisense; TCGAAGGCGTTTTTCGTTGGTCTAG
>probe:Drosophila_2:1636470_at:561:163; Interrogation_Position=205; Antisense; AAATACGTATTCAAGCAGTCGGACA
>probe:Drosophila_2:1636470_at:74:115; Interrogation_Position=218; Antisense; AGCAGTCGGACAACCTAAATGCGTT
>probe:Drosophila_2:1636470_at:541:49; Interrogation_Position=236; Antisense; ATGCGTTGACCATTACGGCAATTAA
>probe:Drosophila_2:1636470_at:311:141; Interrogation_Position=284; Antisense; ACGGAGCAACTGCTGTATTGGTCAG
>probe:Drosophila_2:1636470_at:138:691; Interrogation_Position=299; Antisense; TATTGGTCAGTGGAGGTCCTGGATC
>probe:Drosophila_2:1636470_at:281:503; Interrogation_Position=314; Antisense; GTCCTGGATCCAAAGGAGCAACTAT
>probe:Drosophila_2:1636470_at:473:685; Interrogation_Position=336; Antisense; TATTAAGTTCACTTCCGAACGAGGT
>probe:Drosophila_2:1636470_at:718:133; Interrogation_Position=354; Antisense; ACGAGGTTACGGCATCAAGGATATC
>probe:Drosophila_2:1636470_at:427:229; Interrogation_Position=43; Antisense; AATGTTTTCATATACCTGCCGCCAG
>probe:Drosophila_2:1636470_at:274:475; Interrogation_Position=73; Antisense; GTTACAGCCGCATTCATTTTGCCAA
>probe:Drosophila_2:1636470_at:152:273; Interrogation_Position=83; Antisense; CATTCATTTTGCCAACATTTGCCGC
>probe:Drosophila_2:1636470_at:482:19; Interrogation_Position=99; Antisense; ATTTGCCGCAAATGACTACCTGTGG

Paste this into a BLAST search page for me
CAATTGGCAAAGGATACGGTTTCGATCGAAGGCGTTTTTCGTTGGTCTAGAAATACGTATTCAAGCAGTCGGACAAGCAGTCGGACAACCTAAATGCGTTATGCGTTGACCATTACGGCAATTAAACGGAGCAACTGCTGTATTGGTCAGTATTGGTCAGTGGAGGTCCTGGATCGTCCTGGATCCAAAGGAGCAACTATTATTAAGTTCACTTCCGAACGAGGTACGAGGTTACGGCATCAAGGATATCAATGTTTTCATATACCTGCCGCCAGGTTACAGCCGCATTCATTTTGCCAACATTCATTTTGCCAACATTTGCCGCATTTGCCGCAAATGACTACCTGTGG

Full Affymetrix probeset data:

Annotations for 1636470_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime