Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636471_at:

>probe:Drosophila_2:1636471_at:605:267; Interrogation_Position=1378; Antisense; CAGGAGGATGACTTCAAGTTGCACC
>probe:Drosophila_2:1636471_at:161:307; Interrogation_Position=1401; Antisense; CCTGCCTCTCCTCGTGACAAGAAGA
>probe:Drosophila_2:1636471_at:48:109; Interrogation_Position=1420; Antisense; AGAAGAAAGAAGACGCCCGGTGGCT
>probe:Drosophila_2:1636471_at:473:521; Interrogation_Position=1439; Antisense; GTGGCTCCCGCAAGCAGAGTTTTGA
>probe:Drosophila_2:1636471_at:13:265; Interrogation_Position=1453; Antisense; CAGAGTTTTGACCACCTGGAGGTGA
>probe:Drosophila_2:1636471_at:194:549; Interrogation_Position=1470; Antisense; GGAGGTGAGCTTCACCAGAAGCAAT
>probe:Drosophila_2:1636471_at:296:491; Interrogation_Position=1499; Antisense; GTAACAACTTGCTGACCATCGATGG
>probe:Drosophila_2:1636471_at:610:281; Interrogation_Position=1510; Antisense; CTGACCATCGATGGGAAGCCCTTCA
>probe:Drosophila_2:1636471_at:485:649; Interrogation_Position=1532; Antisense; TCACCCTCAATCGTCGGATCAAGGA
>probe:Drosophila_2:1636471_at:660:63; Interrogation_Position=1556; Antisense; ATGTGTGCTACTGGGAGTGCGTCAA
>probe:Drosophila_2:1636471_at:331:119; Interrogation_Position=1580; Antisense; AGCTGCGCTGCAAGTACATCAAGTG
>probe:Drosophila_2:1636471_at:487:517; Interrogation_Position=1613; Antisense; GTGTGGTGACCAAATCCAATCGGAT
>probe:Drosophila_2:1636471_at:657:233; Interrogation_Position=1625; Antisense; AATCCAATCGGATCTCGGCACTGAG
>probe:Drosophila_2:1636471_at:581:523; Interrogation_Position=1651; Antisense; GGGCTCCACAACCATCCCTAAGTTA

Paste this into a BLAST search page for me
CAGGAGGATGACTTCAAGTTGCACCCCTGCCTCTCCTCGTGACAAGAAGAAGAAGAAAGAAGACGCCCGGTGGCTGTGGCTCCCGCAAGCAGAGTTTTGACAGAGTTTTGACCACCTGGAGGTGAGGAGGTGAGCTTCACCAGAAGCAATGTAACAACTTGCTGACCATCGATGGCTGACCATCGATGGGAAGCCCTTCATCACCCTCAATCGTCGGATCAAGGAATGTGTGCTACTGGGAGTGCGTCAAAGCTGCGCTGCAAGTACATCAAGTGGTGTGGTGACCAAATCCAATCGGATAATCCAATCGGATCTCGGCACTGAGGGGCTCCACAACCATCCCTAAGTTA

Full Affymetrix probeset data:

Annotations for 1636471_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime