FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636472_at:

>probe:Drosophila_2:1636472_at:210:475; Interrogation_Position=3775; Antisense; GTTAAGCTTATTGTTCATTCCCTGA
>probe:Drosophila_2:1636472_at:204:9; Interrogation_Position=3791; Antisense; ATTCCCTGATTGTTTATTGGAGGCC
>probe:Drosophila_2:1636472_at:668:247; Interrogation_Position=3815; Antisense; CAATCGACGTTTCGGCCATGGGTTC
>probe:Drosophila_2:1636472_at:245:19; Interrogation_Position=3843; Antisense; ATTTCGGGCTGCGATGTGCGCTACA
>probe:Drosophila_2:1636472_at:98:169; Interrogation_Position=4004; Antisense; AAATGGAGCGCCTAACTAATTTGTT
>probe:Drosophila_2:1636472_at:516:249; Interrogation_Position=4065; Antisense; CAAGTTTCGTCCTCGTTCCTGAGAA
>probe:Drosophila_2:1636472_at:260:131; Interrogation_Position=4091; Antisense; ACCGAAATGCCCGAACTGTGAGCGA
>probe:Drosophila_2:1636472_at:559:25; Interrogation_Position=4119; Antisense; ATAGAGGTCTCCATGGTGCTGGCGA
>probe:Drosophila_2:1636472_at:610:453; Interrogation_Position=4154; Antisense; GATCACCCTACGTTATAGCGCTTAA
>probe:Drosophila_2:1636472_at:223:581; Interrogation_Position=4274; Antisense; TGGCGATTAGCGCTCCATCGTAAAG
>probe:Drosophila_2:1636472_at:544:179; Interrogation_Position=4304; Antisense; AAACAGCAAACCATCTCGGGACTCT
>probe:Drosophila_2:1636472_at:453:39; Interrogation_Position=4316; Antisense; ATCTCGGGACTCTGGAACTCTGATT
>probe:Drosophila_2:1636472_at:509:383; Interrogation_Position=4330; Antisense; GAACTCTGATTCCAATCCGATGCGA
>probe:Drosophila_2:1636472_at:434:235; Interrogation_Position=4343; Antisense; AATCCGATGCGATCCGAGTGAATCA

Paste this into a BLAST search page for me
GTTAAGCTTATTGTTCATTCCCTGAATTCCCTGATTGTTTATTGGAGGCCCAATCGACGTTTCGGCCATGGGTTCATTTCGGGCTGCGATGTGCGCTACAAAATGGAGCGCCTAACTAATTTGTTCAAGTTTCGTCCTCGTTCCTGAGAAACCGAAATGCCCGAACTGTGAGCGAATAGAGGTCTCCATGGTGCTGGCGAGATCACCCTACGTTATAGCGCTTAATGGCGATTAGCGCTCCATCGTAAAGAAACAGCAAACCATCTCGGGACTCTATCTCGGGACTCTGGAACTCTGATTGAACTCTGATTCCAATCCGATGCGAAATCCGATGCGATCCGAGTGAATCA

Full Affymetrix probeset data:

Annotations for 1636472_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720