FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636473_at:

>probe:Drosophila_2:1636473_at:296:149; Interrogation_Position=1067; Antisense; ACTTTTGGATGTTGTTGCTACCGAC
>probe:Drosophila_2:1636473_at:67:643; Interrogation_Position=524; Antisense; TCTGATGTCGAGTGCCGCTGGGATC
>probe:Drosophila_2:1636473_at:613:45; Interrogation_Position=546; Antisense; ATCCCATGCCCTGTGATGACGTGAA
>probe:Drosophila_2:1636473_at:292:669; Interrogation_Position=585; Antisense; TACTGATTGAAGTGCCGCGTATCGG
>probe:Drosophila_2:1636473_at:685:483; Interrogation_Position=603; Antisense; GTATCGGGAAGTGGCCATGCTGCAA
>probe:Drosophila_2:1636473_at:189:503; Interrogation_Position=681; Antisense; GTCGAATTCCCACTTGCTGCAAGAA
>probe:Drosophila_2:1636473_at:120:109; Interrogation_Position=702; Antisense; AGAAGCGTCGCACCAAGTATCCCAG
>probe:Drosophila_2:1636473_at:659:179; Interrogation_Position=738; Antisense; GCAAAAAGGAACTGCTCGACCCCAT
>probe:Drosophila_2:1636473_at:598:45; Interrogation_Position=761; Antisense; ATCCCACCATGCGAGTGCGAGAAGA
>probe:Drosophila_2:1636473_at:22:297; Interrogation_Position=799; Antisense; CGACGTGTATGCATATTTCCGCCAT
>probe:Drosophila_2:1636473_at:605:187; Interrogation_Position=834; Antisense; AACTTCGGTCCCTGAAAGAGCTTGG
>probe:Drosophila_2:1636473_at:297:575; Interrogation_Position=866; Antisense; GGCGGTATAAGAAGCCCACCTGGAT
>probe:Drosophila_2:1636473_at:241:249; Interrogation_Position=907; Antisense; AATTGGCTAGCGTGTATTGCTGTTC
>probe:Drosophila_2:1636473_at:650:625; Interrogation_Position=975; Antisense; TGCCGCCTTTTACCAATCCTGATTA

Paste this into a BLAST search page for me
ACTTTTGGATGTTGTTGCTACCGACTCTGATGTCGAGTGCCGCTGGGATCATCCCATGCCCTGTGATGACGTGAATACTGATTGAAGTGCCGCGTATCGGGTATCGGGAAGTGGCCATGCTGCAAGTCGAATTCCCACTTGCTGCAAGAAAGAAGCGTCGCACCAAGTATCCCAGGCAAAAAGGAACTGCTCGACCCCATATCCCACCATGCGAGTGCGAGAAGACGACGTGTATGCATATTTCCGCCATAACTTCGGTCCCTGAAAGAGCTTGGGGCGGTATAAGAAGCCCACCTGGATAATTGGCTAGCGTGTATTGCTGTTCTGCCGCCTTTTACCAATCCTGATTA

Full Affymetrix probeset data:

Annotations for 1636473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720