Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636474_at:

>probe:Drosophila_2:1636474_at:694:223; Interrogation_Position=2003; Antisense; AAGGAGTTCATGTTCGACGGTCAGA
>probe:Drosophila_2:1636474_at:64:189; Interrogation_Position=2037; Antisense; AACAGGTCTTTGTCGTCGTTGCCAT
>probe:Drosophila_2:1636474_at:431:469; Interrogation_Position=2054; Antisense; GTTGCCATCATTTGCATTCCTTGGA
>probe:Drosophila_2:1636474_at:711:593; Interrogation_Position=2085; Antisense; TGGGCAAGCCTCTGTACATCATGAT
>probe:Drosophila_2:1636474_at:714:593; Interrogation_Position=2187; Antisense; TGGGCGAGATCTTCATCCATCAGGC
>probe:Drosophila_2:1636474_at:184:363; Interrogation_Position=2225; Antisense; GAATATGTCCTGAGTACGGTCTCCC
>probe:Drosophila_2:1636474_at:538:645; Interrogation_Position=2258; Antisense; TCATACCTCCGATTGTGGGCCTTAT
>probe:Drosophila_2:1636474_at:207:687; Interrogation_Position=2354; Antisense; TATATTGGCGGCATTCTCATCTACG
>probe:Drosophila_2:1636474_at:134:641; Interrogation_Position=2373; Antisense; TCTACGTATTCTTTGGAGCCTGGGC
>probe:Drosophila_2:1636474_at:228:593; Interrogation_Position=2393; Antisense; TGGGCGTTGCTCACAGTCGGTATCC
>probe:Drosophila_2:1636474_at:704:589; Interrogation_Position=2418; Antisense; TGGTGCTCATCGAAGGACTCTCGGC
>probe:Drosophila_2:1636474_at:707:157; Interrogation_Position=2451; Antisense; ACACACTGCGTTTGCACTGGGTTGA
>probe:Drosophila_2:1636474_at:108:253; Interrogation_Position=2485; Antisense; CAAGTTCTACGAGGGCGCTGGTTAC
>probe:Drosophila_2:1636474_at:692:413; Interrogation_Position=2516; Antisense; GAGCCTTTTGCCTTTAAGACCATTT

Paste this into a BLAST search page for me
AAGGAGTTCATGTTCGACGGTCAGAAACAGGTCTTTGTCGTCGTTGCCATGTTGCCATCATTTGCATTCCTTGGATGGGCAAGCCTCTGTACATCATGATTGGGCGAGATCTTCATCCATCAGGCGAATATGTCCTGAGTACGGTCTCCCTCATACCTCCGATTGTGGGCCTTATTATATTGGCGGCATTCTCATCTACGTCTACGTATTCTTTGGAGCCTGGGCTGGGCGTTGCTCACAGTCGGTATCCTGGTGCTCATCGAAGGACTCTCGGCACACACTGCGTTTGCACTGGGTTGACAAGTTCTACGAGGGCGCTGGTTACGAGCCTTTTGCCTTTAAGACCATTT

Full Affymetrix probeset data:

Annotations for 1636474_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime