FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636475_at:

>probe:Drosophila_2:1636475_at:370:49; Interrogation_Position=1019; Antisense; ATCCAATGACGGCAGGCGACTCCAT
>probe:Drosophila_2:1636475_at:132:405; Interrogation_Position=1036; Antisense; GACTCCATGATGTACCAGCACAGTG
>probe:Drosophila_2:1636475_at:609:295; Interrogation_Position=1112; Antisense; CGAACATGAACAGCTGCTCCTCGGT
>probe:Drosophila_2:1636475_at:394:177; Interrogation_Position=1176; Antisense; AAACGAGCTGAACGGCGAGCCCATG
>probe:Drosophila_2:1636475_at:502:155; Interrogation_Position=1224; Antisense; ACAGACTCACCAACATCAGCAACAG
>probe:Drosophila_2:1636475_at:637:113; Interrogation_Position=1301; Antisense; AGCAGCTTCCGCAGTCTATGCAGTC
>probe:Drosophila_2:1636475_at:35:85; Interrogation_Position=1313; Antisense; AGTCTATGCAGTCGCCGTCAGATGG
>probe:Drosophila_2:1636475_at:718:495; Interrogation_Position=1329; Antisense; GTCAGATGGCGCCAACGACACACTC
>probe:Drosophila_2:1636475_at:224:329; Interrogation_Position=1377; Antisense; GCGGGCGTCCGAACTAAATGCGATT
>probe:Drosophila_2:1636475_at:533:463; Interrogation_Position=1398; Antisense; GATTCCTTCCTACCTACAGATGGCG
>probe:Drosophila_2:1636475_at:57:101; Interrogation_Position=1415; Antisense; AGATGGCGCCACACAACTACGAACA
>probe:Drosophila_2:1636475_at:443:243; Interrogation_Position=940; Antisense; AATATAACCAATATCGCCATGGGCG
>probe:Drosophila_2:1636475_at:582:307; Interrogation_Position=956; Antisense; CCATGGGCGATGGTCTCTGTGGCAC
>probe:Drosophila_2:1636475_at:229:45; Interrogation_Position=998; Antisense; ATCGCTGGAGCGTGGGTGTCAATCC

Paste this into a BLAST search page for me
ATCCAATGACGGCAGGCGACTCCATGACTCCATGATGTACCAGCACAGTGCGAACATGAACAGCTGCTCCTCGGTAAACGAGCTGAACGGCGAGCCCATGACAGACTCACCAACATCAGCAACAGAGCAGCTTCCGCAGTCTATGCAGTCAGTCTATGCAGTCGCCGTCAGATGGGTCAGATGGCGCCAACGACACACTCGCGGGCGTCCGAACTAAATGCGATTGATTCCTTCCTACCTACAGATGGCGAGATGGCGCCACACAACTACGAACAAATATAACCAATATCGCCATGGGCGCCATGGGCGATGGTCTCTGTGGCACATCGCTGGAGCGTGGGTGTCAATCC

Full Affymetrix probeset data:

Annotations for 1636475_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720