FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636478_at:

>probe:Drosophila_2:1636478_at:460:413; Interrogation_Position=1115; Antisense; GACCTCCGCGCTGGCATTTGGAAAA
>probe:Drosophila_2:1636478_at:201:51; Interrogation_Position=1159; Antisense; ATGCACGCCGAATTCGACAGTCTGG
>probe:Drosophila_2:1636478_at:671:725; Interrogation_Position=1235; Antisense; TTGTGAAACCCTCAAGACCCGTGGT
>probe:Drosophila_2:1636478_at:101:105; Interrogation_Position=1249; Antisense; AGACCCGTGGTGGTATTCAGCACCT
>probe:Drosophila_2:1636478_at:142:355; Interrogation_Position=1268; Antisense; GCACCTGCAAGGAGCTGTTACAAGA
>probe:Drosophila_2:1636478_at:269:223; Interrogation_Position=1321; Antisense; AAGGTGACGGGTCTGCACTTGACCT
>probe:Drosophila_2:1636478_at:333:249; Interrogation_Position=1377; Antisense; CAATCGCACACATCCGGAAGTGAAT
>probe:Drosophila_2:1636478_at:10:171; Interrogation_Position=1411; Antisense; AATAGTGGCTACCTTTTGACGGGCT
>probe:Drosophila_2:1636478_at:388:277; Interrogation_Position=1423; Antisense; CTTTTGACGGGCTATACGCTTAGAT
>probe:Drosophila_2:1636478_at:215:555; Interrogation_Position=894; Antisense; GGACGCGAAGGCCACAGATATTCCC
>probe:Drosophila_2:1636478_at:498:95; Interrogation_Position=909; Antisense; AGATATTCCCGTTGTGGAGCCCAGT
>probe:Drosophila_2:1636478_at:334:593; Interrogation_Position=921; Antisense; TGTGGAGCCCAGTGAAAACGAACCT
>probe:Drosophila_2:1636478_at:319:381; Interrogation_Position=940; Antisense; GAACCTCAGGAAACCCAGCTGGAGA
>probe:Drosophila_2:1636478_at:323:423; Interrogation_Position=961; Antisense; GAGACGCCAACGGAGGAACAACCTG

Paste this into a BLAST search page for me
GACCTCCGCGCTGGCATTTGGAAAAATGCACGCCGAATTCGACAGTCTGGTTGTGAAACCCTCAAGACCCGTGGTAGACCCGTGGTGGTATTCAGCACCTGCACCTGCAAGGAGCTGTTACAAGAAAGGTGACGGGTCTGCACTTGACCTCAATCGCACACATCCGGAAGTGAATAATAGTGGCTACCTTTTGACGGGCTCTTTTGACGGGCTATACGCTTAGATGGACGCGAAGGCCACAGATATTCCCAGATATTCCCGTTGTGGAGCCCAGTTGTGGAGCCCAGTGAAAACGAACCTGAACCTCAGGAAACCCAGCTGGAGAGAGACGCCAACGGAGGAACAACCTG

Full Affymetrix probeset data:

Annotations for 1636478_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720