FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636482_at:

>probe:Drosophila_2:1636482_at:597:205; Interrogation_Position=1035; Antisense; AAGCTGGAACCATGATCCCGACTAC
>probe:Drosophila_2:1636482_at:132:355; Interrogation_Position=1062; Antisense; GCACCACGTGGTAAGGACATTGTAT
>probe:Drosophila_2:1636482_at:456:337; Interrogation_Position=1124; Antisense; GCTCGACCCTGTGTATGTTTTTCAA
>probe:Drosophila_2:1636482_at:373:695; Interrogation_Position=1143; Antisense; TTTCAATTCGTTCCTTTCTCAGACA
>probe:Drosophila_2:1636482_at:52:399; Interrogation_Position=1164; Antisense; GACACAGATGTCTAATTCACTCGAC
>probe:Drosophila_2:1636482_at:105:713; Interrogation_Position=1179; Antisense; TTCACTCGACGTACAAAGCAGCAGC
>probe:Drosophila_2:1636482_at:408:195; Interrogation_Position=1234; Antisense; AACGTTCTTTTTCTAGCGTCATAAG
>probe:Drosophila_2:1636482_at:196:181; Interrogation_Position=1323; Antisense; AAAACATTGTCTTGAGGCGAACTTG
>probe:Drosophila_2:1636482_at:657:519; Interrogation_Position=822; Antisense; GGGCGACGTAGTATACTGCCGCACT
>probe:Drosophila_2:1636482_at:60:303; Interrogation_Position=840; Antisense; CCGCACTCGGGCAAGATCACAATGG
>probe:Drosophila_2:1636482_at:76:77; Interrogation_Position=886; Antisense; AGGAGAACAGTTTGCTCGAGCAGCA
>probe:Drosophila_2:1636482_at:298:637; Interrogation_Position=901; Antisense; TCGAGCAGCAGAACGACGCCTGTCT
>probe:Drosophila_2:1636482_at:680:499; Interrogation_Position=922; Antisense; GTCTGCAGTCGCTCGTGCGCAAGGA
>probe:Drosophila_2:1636482_at:593:191; Interrogation_Position=972; Antisense; AACTTTCTGGCGTATATGGAGCGGC

Paste this into a BLAST search page for me
AAGCTGGAACCATGATCCCGACTACGCACCACGTGGTAAGGACATTGTATGCTCGACCCTGTGTATGTTTTTCAATTTCAATTCGTTCCTTTCTCAGACAGACACAGATGTCTAATTCACTCGACTTCACTCGACGTACAAAGCAGCAGCAACGTTCTTTTTCTAGCGTCATAAGAAAACATTGTCTTGAGGCGAACTTGGGGCGACGTAGTATACTGCCGCACTCCGCACTCGGGCAAGATCACAATGGAGGAGAACAGTTTGCTCGAGCAGCATCGAGCAGCAGAACGACGCCTGTCTGTCTGCAGTCGCTCGTGCGCAAGGAAACTTTCTGGCGTATATGGAGCGGC

Full Affymetrix probeset data:

Annotations for 1636482_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720