Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636483_at:

>probe:Drosophila_2:1636483_at:47:185; Interrogation_Position=3064; Antisense; AAAAGGATTGCTTCCTTCCACTACT
>probe:Drosophila_2:1636483_at:552:279; Interrogation_Position=3101; Antisense; CTCATGGCTGTTGTGATTTCTCTCA
>probe:Drosophila_2:1636483_at:710:309; Interrogation_Position=3131; Antisense; CCAAATCTACTCTACAGCTCTGTAA
>probe:Drosophila_2:1636483_at:648:533; Interrogation_Position=3219; Antisense; GGTGCAGCTAGAGCGGATTTCCCTT
>probe:Drosophila_2:1636483_at:615:457; Interrogation_Position=3234; Antisense; GATTTCCCTTCATGAATTTCTGGCC
>probe:Drosophila_2:1636483_at:232:709; Interrogation_Position=3319; Antisense; TTACAGTGTCACCTCATATTTGCCC
>probe:Drosophila_2:1636483_at:215:683; Interrogation_Position=3335; Antisense; TATTTGCCCACGTCATCGATACTAA
>probe:Drosophila_2:1636483_at:397:19; Interrogation_Position=3395; Antisense; ATTTGACGCTCTTTGAAAGCCGCCT
>probe:Drosophila_2:1636483_at:207:175; Interrogation_Position=3410; Antisense; AAAGCCGCCTGCAGAATGCGCTGAA
>probe:Drosophila_2:1636483_at:671:377; Interrogation_Position=3444; Antisense; GAAGCTCACGCTGGCCGGCAAGGAT
>probe:Drosophila_2:1636483_at:686:199; Interrogation_Position=3510; Antisense; AACCTTGACTGGGAAACATGGCCTA
>probe:Drosophila_2:1636483_at:230:361; Interrogation_Position=3543; Antisense; GCAATCGTCGACAGCTTGCTTAAAG
>probe:Drosophila_2:1636483_at:90:173; Interrogation_Position=3564; Antisense; AAAGCATTTGCACATGCTGCTCGCC
>probe:Drosophila_2:1636483_at:664:571; Interrogation_Position=3590; Antisense; GGCTACGGGCCATGTGCGAAACACA

Paste this into a BLAST search page for me
AAAAGGATTGCTTCCTTCCACTACTCTCATGGCTGTTGTGATTTCTCTCACCAAATCTACTCTACAGCTCTGTAAGGTGCAGCTAGAGCGGATTTCCCTTGATTTCCCTTCATGAATTTCTGGCCTTACAGTGTCACCTCATATTTGCCCTATTTGCCCACGTCATCGATACTAAATTTGACGCTCTTTGAAAGCCGCCTAAAGCCGCCTGCAGAATGCGCTGAAGAAGCTCACGCTGGCCGGCAAGGATAACCTTGACTGGGAAACATGGCCTAGCAATCGTCGACAGCTTGCTTAAAGAAAGCATTTGCACATGCTGCTCGCCGGCTACGGGCCATGTGCGAAACACA

Full Affymetrix probeset data:

Annotations for 1636483_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime