FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636484_at:

>probe:Drosophila_2:1636484_at:263:499; Interrogation_Position=1071; Antisense; GTCGTTGTGTAACCCAAGCTGGGAA
>probe:Drosophila_2:1636484_at:370:283; Interrogation_Position=1089; Antisense; CTGGGAAGTATTTTGAGGCGCGCCT
>probe:Drosophila_2:1636484_at:535:607; Interrogation_Position=1102; Antisense; TGAGGCGCGCCTTAGGAGGACTCAT
>probe:Drosophila_2:1636484_at:719:437; Interrogation_Position=1117; Antisense; GAGGACTCATCGTTAACTCCAATTT
>probe:Drosophila_2:1636484_at:396:455; Interrogation_Position=1147; Antisense; GATACTTCCACTGATTTGGTGTGCT
>probe:Drosophila_2:1636484_at:101:517; Interrogation_Position=1165; Antisense; GTGTGCTGGAGATTCGGAGCTTAAC
>probe:Drosophila_2:1636484_at:529:185; Interrogation_Position=1207; Antisense; AACACTCGTTTTTATATAGCTGCAA
>probe:Drosophila_2:1636484_at:422:479; Interrogation_Position=1310; Antisense; GTTTGGTTATCCATCCACAATTCGA
>probe:Drosophila_2:1636484_at:87:153; Interrogation_Position=1361; Antisense; ACATCGTACGATGTTAACCAATCTG
>probe:Drosophila_2:1636484_at:107:481; Interrogation_Position=1407; Antisense; GTTTGTAAGCTCTCCTTTGTTGACA
>probe:Drosophila_2:1636484_at:259:147; Interrogation_Position=1528; Antisense; ACTATTTCTGTGACGATTACCTAAT
>probe:Drosophila_2:1636484_at:60:365; Interrogation_Position=1562; Antisense; GAATTTCAGTTTAATTTCAGCTGCA
>probe:Drosophila_2:1636484_at:358:415; Interrogation_Position=1594; Antisense; GACCAAGCTGTCCAATCATACTGTA
>probe:Drosophila_2:1636484_at:80:29; Interrogation_Position=1611; Antisense; ATACTGTATCTCTTACTAGTTACTA

Paste this into a BLAST search page for me
GTCGTTGTGTAACCCAAGCTGGGAACTGGGAAGTATTTTGAGGCGCGCCTTGAGGCGCGCCTTAGGAGGACTCATGAGGACTCATCGTTAACTCCAATTTGATACTTCCACTGATTTGGTGTGCTGTGTGCTGGAGATTCGGAGCTTAACAACACTCGTTTTTATATAGCTGCAAGTTTGGTTATCCATCCACAATTCGAACATCGTACGATGTTAACCAATCTGGTTTGTAAGCTCTCCTTTGTTGACAACTATTTCTGTGACGATTACCTAATGAATTTCAGTTTAATTTCAGCTGCAGACCAAGCTGTCCAATCATACTGTAATACTGTATCTCTTACTAGTTACTA

Full Affymetrix probeset data:

Annotations for 1636484_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720