FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636485_at:

>probe:Drosophila_2:1636485_at:542:239; Interrogation_Position=515; Antisense; AATAAATGTGAGTTACCCTTTGCCA
>probe:Drosophila_2:1636485_at:110:169; Interrogation_Position=518; Antisense; AAATGTGAGTTACCCTTTGCCATAT
>probe:Drosophila_2:1636485_at:423:595; Interrogation_Position=521; Antisense; TGTGAGTTACCCTTTGCCATATATG
>probe:Drosophila_2:1636485_at:490:429; Interrogation_Position=524; Antisense; GAGTTACCCTTTGCCATATATGTGC
>probe:Drosophila_2:1636485_at:499:669; Interrogation_Position=528; Antisense; TACCCTTTGCCATATATGTGCGTGC
>probe:Drosophila_2:1636485_at:706:275; Interrogation_Position=532; Antisense; CTTTGCCATATATGTGCGTGCATTT
>probe:Drosophila_2:1636485_at:321:63; Interrogation_Position=543; Antisense; ATGTGCGTGCATTTGTATCACTTGC
>probe:Drosophila_2:1636485_at:463:291; Interrogation_Position=548; Antisense; CGTGCATTTGTATCACTTGCTCGAC
>probe:Drosophila_2:1636485_at:154:21; Interrogation_Position=553; Antisense; ATTTGTATCACTTGCTCGACTCTTT
>probe:Drosophila_2:1636485_at:294:481; Interrogation_Position=557; Antisense; GTATCACTTGCTCGACTCTTTTTAA
>probe:Drosophila_2:1636485_at:244:33; Interrogation_Position=559; Antisense; ATCACTTGCTCGACTCTTTTTAAGC
>probe:Drosophila_2:1636485_at:695:147; Interrogation_Position=562; Antisense; ACTTGCTCGACTCTTTTTAAGCCAT
>probe:Drosophila_2:1636485_at:262:337; Interrogation_Position=566; Antisense; GCTCGACTCTTTTTAAGCCATCAAT
>probe:Drosophila_2:1636485_at:435:279; Interrogation_Position=572; Antisense; CTCTTTTTAAGCCATCAATTTGCGG

Paste this into a BLAST search page for me
AATAAATGTGAGTTACCCTTTGCCAAAATGTGAGTTACCCTTTGCCATATTGTGAGTTACCCTTTGCCATATATGGAGTTACCCTTTGCCATATATGTGCTACCCTTTGCCATATATGTGCGTGCCTTTGCCATATATGTGCGTGCATTTATGTGCGTGCATTTGTATCACTTGCCGTGCATTTGTATCACTTGCTCGACATTTGTATCACTTGCTCGACTCTTTGTATCACTTGCTCGACTCTTTTTAAATCACTTGCTCGACTCTTTTTAAGCACTTGCTCGACTCTTTTTAAGCCATGCTCGACTCTTTTTAAGCCATCAATCTCTTTTTAAGCCATCAATTTGCGG

Full Affymetrix probeset data:

Annotations for 1636485_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720