FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636486_at:

>probe:Drosophila_2:1636486_at:372:367; Interrogation_Position=345; Antisense; GAATGCAGGTTCTCGTTTCCAACTT
>probe:Drosophila_2:1636486_at:89:377; Interrogation_Position=374; Antisense; GAAGAACAGCTGGATCGCTACGAAA
>probe:Drosophila_2:1636486_at:418:671; Interrogation_Position=392; Antisense; TACGAAATGTATCGTCGCTCTGCCT
>probe:Drosophila_2:1636486_at:28:301; Interrogation_Position=427; Antisense; CGCCGTCAAGCGTCTAATGCAAACT
>probe:Drosophila_2:1636486_at:428:655; Interrogation_Position=441; Antisense; TAATGCAAACTATCACCGGCTGTTC
>probe:Drosophila_2:1636486_at:27:603; Interrogation_Position=461; Antisense; TGTTCCGTGTCCCAGAATGTTGTGA
>probe:Drosophila_2:1636486_at:613:367; Interrogation_Position=475; Antisense; GAATGTTGTGATAGCCATGTCCGGC
>probe:Drosophila_2:1636486_at:523:59; Interrogation_Position=491; Antisense; ATGTCCGGCATTGCGAAGGTCTTCG
>probe:Drosophila_2:1636486_at:403:203; Interrogation_Position=534; Antisense; AAGCCCTCGACGTGATGGAGGCCCA
>probe:Drosophila_2:1636486_at:525:223; Interrogation_Position=558; Antisense; AAGGTGAATCCGGTGCCCTGCAGCC
>probe:Drosophila_2:1636486_at:689:305; Interrogation_Position=574; Antisense; CCTGCAGCCCAAATTCATACGAGAG
>probe:Drosophila_2:1636486_at:509:437; Interrogation_Position=613; Antisense; GAGGACCAAGGATCGGATGCCCATA
>probe:Drosophila_2:1636486_at:54:51; Interrogation_Position=629; Antisense; ATGCCCATAGGCAGATACCAGCAGC
>probe:Drosophila_2:1636486_at:445:129; Interrogation_Position=645; Antisense; ACCAGCAGCCCTATTTCAGACTGAA

Paste this into a BLAST search page for me
GAATGCAGGTTCTCGTTTCCAACTTGAAGAACAGCTGGATCGCTACGAAATACGAAATGTATCGTCGCTCTGCCTCGCCGTCAAGCGTCTAATGCAAACTTAATGCAAACTATCACCGGCTGTTCTGTTCCGTGTCCCAGAATGTTGTGAGAATGTTGTGATAGCCATGTCCGGCATGTCCGGCATTGCGAAGGTCTTCGAAGCCCTCGACGTGATGGAGGCCCAAAGGTGAATCCGGTGCCCTGCAGCCCCTGCAGCCCAAATTCATACGAGAGGAGGACCAAGGATCGGATGCCCATAATGCCCATAGGCAGATACCAGCAGCACCAGCAGCCCTATTTCAGACTGAA

Full Affymetrix probeset data:

Annotations for 1636486_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720