FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636488_at:

>probe:Drosophila_2:1636488_at:341:231; Interrogation_Position=382; Antisense; AATGCTAATTGTCACCATGGCCTGG
>probe:Drosophila_2:1636488_at:417:173; Interrogation_Position=450; Antisense; AAAGCTTCCGCGAGGAGCATCAGCA
>probe:Drosophila_2:1636488_at:434:65; Interrogation_Position=530; Antisense; ATGGTCGGTCCATTCATGCAGGGCC
>probe:Drosophila_2:1636488_at:642:53; Interrogation_Position=545; Antisense; ATGCAGGGCCTATTCTTGATTGGCA
>probe:Drosophila_2:1636488_at:149:467; Interrogation_Position=562; Antisense; GATTGGCATCATCTACTGGTATTCC
>probe:Drosophila_2:1636488_at:578:547; Interrogation_Position=591; Antisense; GGATGATGTCCATGATCAACGACTA
>probe:Drosophila_2:1636488_at:410:409; Interrogation_Position=661; Antisense; GACGAGGGCAGAGACACCCATCAAT
>probe:Drosophila_2:1636488_at:626:703; Interrogation_Position=708; Antisense; TTAGGGAGCTGGACACTCCGGACGA
>probe:Drosophila_2:1636488_at:333:145; Interrogation_Position=722; Antisense; ACTCCGGACGAGGTGGCTAGAATTC
>probe:Drosophila_2:1636488_at:592:563; Interrogation_Position=751; Antisense; GGAAGGAACTGAATCTCCGCCCATG
>probe:Drosophila_2:1636488_at:601:593; Interrogation_Position=774; Antisense; TGGGAAACACCTATTGCCACATCCT
>probe:Drosophila_2:1636488_at:34:259; Interrogation_Position=791; Antisense; CACATCCTTCGACGATTCTTGGAGA
>probe:Drosophila_2:1636488_at:228:713; Interrogation_Position=806; Antisense; TTCTTGGAGATTACCGGCACTCTAC
>probe:Drosophila_2:1636488_at:383:309; Interrogation_Position=830; Antisense; CCACCATTCGATGTTTGCCTAGTTA

Paste this into a BLAST search page for me
AATGCTAATTGTCACCATGGCCTGGAAAGCTTCCGCGAGGAGCATCAGCAATGGTCGGTCCATTCATGCAGGGCCATGCAGGGCCTATTCTTGATTGGCAGATTGGCATCATCTACTGGTATTCCGGATGATGTCCATGATCAACGACTAGACGAGGGCAGAGACACCCATCAATTTAGGGAGCTGGACACTCCGGACGAACTCCGGACGAGGTGGCTAGAATTCGGAAGGAACTGAATCTCCGCCCATGTGGGAAACACCTATTGCCACATCCTCACATCCTTCGACGATTCTTGGAGATTCTTGGAGATTACCGGCACTCTACCCACCATTCGATGTTTGCCTAGTTA

Full Affymetrix probeset data:

Annotations for 1636488_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720