FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636489_at:

>probe:Drosophila_2:1636489_at:163:587; Interrogation_Position=1896; Antisense; TGGACTACTACACTCGCTTCTATGC
>probe:Drosophila_2:1636489_at:61:355; Interrogation_Position=1927; Antisense; GCACCAGGTGTCCATCTTTGCGGAG
>probe:Drosophila_2:1636489_at:429:37; Interrogation_Position=1940; Antisense; ATCTTTGCGGAGACGGCGGCCAGTA
>probe:Drosophila_2:1636489_at:298:215; Interrogation_Position=1988; Antisense; AAGATGCGCATCCAGCTCGAGGAGA
>probe:Drosophila_2:1636489_at:486:559; Interrogation_Position=2064; Antisense; GGAAACGACACACCGTATTGCTGCC
>probe:Drosophila_2:1636489_at:149:573; Interrogation_Position=2092; Antisense; GGCTGTGCGCGAGAAGAACCGTATT
>probe:Drosophila_2:1636489_at:658:481; Interrogation_Position=2112; Antisense; GTATTAACTTCTTCCGGCTGAGGGA
>probe:Drosophila_2:1636489_at:512:439; Interrogation_Position=2207; Antisense; GAGGCGATACGAACGCTCAAGATCA
>probe:Drosophila_2:1636489_at:469:39; Interrogation_Position=2250; Antisense; ATCTCTACGAAACTGGACTCCTGAC
>probe:Drosophila_2:1636489_at:209:187; Interrogation_Position=2276; Antisense; AACACGGACATGGTCGTCTATCCGC
>probe:Drosophila_2:1636489_at:265:39; Interrogation_Position=2301; Antisense; ATCTCTATCACAACTTGCAGCACGG
>probe:Drosophila_2:1636489_at:515:617; Interrogation_Position=2316; Antisense; TGCAGCACGGCTACGACATCAAACG
>probe:Drosophila_2:1636489_at:362:489; Interrogation_Position=2340; Antisense; GTACTCCATAGTCAGTCATTTCGCC
>probe:Drosophila_2:1636489_at:416:105; Interrogation_Position=2380; Antisense; AGACTACTTACACACATCCACGATG

Paste this into a BLAST search page for me
TGGACTACTACACTCGCTTCTATGCGCACCAGGTGTCCATCTTTGCGGAGATCTTTGCGGAGACGGCGGCCAGTAAAGATGCGCATCCAGCTCGAGGAGAGGAAACGACACACCGTATTGCTGCCGGCTGTGCGCGAGAAGAACCGTATTGTATTAACTTCTTCCGGCTGAGGGAGAGGCGATACGAACGCTCAAGATCAATCTCTACGAAACTGGACTCCTGACAACACGGACATGGTCGTCTATCCGCATCTCTATCACAACTTGCAGCACGGTGCAGCACGGCTACGACATCAAACGGTACTCCATAGTCAGTCATTTCGCCAGACTACTTACACACATCCACGATG

Full Affymetrix probeset data:

Annotations for 1636489_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720